Src tyrosine kinase is crucial for potassium channel function in

Src tyrosine kinase is crucial for potassium channel function in
human pulmonary arteries
Chandran Nagaraj MSc1,2, Bi Tang MD, PhD2, Zoltán Bálint PhD1, Malgorzata Wygrecka,
PhD7, Andelko Hrzenjak PhD2, Grazyna Kwapiszewska PhD1, Elvira Stacher MD3, Joerg
Lindenmann MD4, E. Kenneth Weir MD5, Horst Olschewski MD, PhD2 , Andrea Olschewski
MD, PhD1,6.
1
Ludwig Boltzmann Institute for Lung Vascular Research, Graz, Austria
2
Division of Pulmonology, Department of Internal Medicine, Medical University of Graz,
Austria
3
Institute of Pathology, Medical University of Graz, Austria
4
Division of Thoracic and Hyperbaric Surgery, Department of Surgery, Medical
University of Graz, Austria
5
Department of Medicine, VA Medical Center and University of Minnesota, Minnesota,
USA
6
Experimental Anesthesiology, Department of Anesthesia and Intensive Care
Medicine, Medical University of Graz, Austria
7
Department of Biochemistry University of Giessen Lung Center, Giessen, Germany
Corresponding Author: Andrea Olschewski, Ludwig Boltzmann Institute for Lung Vascular
Research & Experimental Anesthesiology of the Department of Anesthesia and Intensive
Care Medicine, Medical University of Graz, Stiftingtalstr. 24, A-8036 Graz, Austria
Tel: (43) 316-385-72057; Fax: (43) 316-385-72058
Address electronic mail to: andrea.olschewski@medunigraz.at
Short title: Nagaraj et al: SrcTK regulates K+ channels in human PASMCs
1
Methods
Preparation of Human Primary Pulmonary Artery Smooth Muscle Cells and Cell
Culture
The adventitia from small arteries with diameters of <1mm was carefully removed under
microscopic guidance and media pieces (<1mm3) were placed onto 16-mm coverslips with
500µl culture medium (Lonza SMC Medium; Lonza Group Ltd, Switzerland). Cells were
maintained at 37°C, medium was initially changed after 24h, and then every 48h thereafter.
PASMCs grown on coverslips were used for patch-clamp recordings, intracellular calcium
measurements and siRNA transfection.
SMC identity was verified by their characteristic appearance in phase-contrast microscopy.
The purity of PASMC cultures was confirmed using indirect immunofluorescent antibody
staining for smooth muscle-specific isoforms of (-smooth muscle actin (at least 95% of cells
stained positive) and lack of staining for von Willebrand factor.
Electrophysiology
The whole-cell patch-clamp technique on hPASMC was used as previously described to
measure the resting membrane potential under current clamp and macroscopic K+ currents
under voltage clamp[1]. Cells were superfused at room temperature with bath solution of the
following composition (in mmol/L): NaCl 140.5, KCl 5.5, CaCl2 1.5, MgCl2 1, Glucose 10,
Na2HPO4 0.5, KH2PO4 0.5, HEPES 10; adjusted to pH 7.3 with NaOH. For TASK-1
recording, pipettes were filled with the following solutions: (in mmol/L): KCl 20, Kmethanesulphonate (to suppress Cl- currents) 135, MgCl2 1, CaCl2 0.1, Na2ATP 2,
ethyleneglycol bis(ß-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) 3, HEPES 20; pH
adjusted to 7.2 with KOH. The non-inactivating TASK-1 K+ current (IKN) was obtained from
the holding potential of 0 mV, by stepping the voltage to 60 mV and then ramping to -100 mV
over a period of 1.6 seconds. To isolate the non-inactivating TASK-1 K+ current (IKN) from
other voltage-dependent K+ currents, cells were clamped at 0 mV for at least 5 min as
2
previously described[1]. As we have shown, under these conditions TEA, ITX or 4-AP have
no significant effect on TASK-1 current[1]. For KCa recording, the same bath solution was
used and a pipette solution with the following components: (in mmol/L): KCl 20, Kmethanesulphonate 135, MgCl2 1, CaCl2 1, Na2ATP 2, EGTA 0.1, HEPES 20; pH adjusted to
7.2 with KOH. The free [Ca2+] was 900nM, which promotes L-type Ca channel activation. The
KCa currents were obtained under whole-cell patch-clamp conditions, from a holding potential
of –20 mV, with 10 mV depolarizing pulses lasting 400 ms, to +50 mV.
Pipettes pulled from borosilicate glass tube (GC 150, Clark Electromedical Instruments,
Pangbourne, UK) were fabricated on a P-97 electrode puller (Sutter Instruments, Novato,
CA, USA) and fire-polished to give a final resistance of 2 – 3 MΩ for whole-cell recording.
The effective corner frequency of the low-pass filter was 0.5-5 kHz. The frequency of
digitization was at least twice that of the filter. No leak subtraction was made. The data were
stored and analyzed with commercially available pCLAMP 9.0 software (Axon Instruments,
Foster City, CA, USA).
Calcium measurements
The fluorescent dye fluo-4-AM was used for detection for detection of changes in intracellular
calcium in hPAMSCs because i) stronger absorption by Fluo-4 permits the use of lower dye
concentrations and therefore the phototoxicity to live cells is lower, and ii) Fluo-4 is more
sensitive to detect small changes in calcium and more stable (significantly reduced
bleaching).
The cells were cultured on glass coverslips until confluency and loaded in the dark for 30 min
with the fluorescent dye fluo-4-AM (2 µM) followed by washing with 1.8 mmol/L Ca2+
containing bath solution. After 15 min a single glass coverslip was mounted on the stage of a
Zeiss
200M
inverted
epifluorescence
microscope
coupled
to
a
PolyChrome
V
monochromator (Till Photonics, Germany) light source in a sealed, temperature-controlled
RC-21B imaging chamber (Warner Instruments, USA) and perfused with bath solution.
Fluorescence images were obtained with excitation at 490 nm. The emitted light was
3
collected at 516 nm by an air cooled Andor Ixon camera. Measurements were made every
3s. Background fluorescence was recorded from each cover slide and subtracted before
calculation. The fluorescence value of the last 30 measurement points (90 s) prior to
application of hypoxia were averaged and considered as baseline value. This value has been
subtracted from the maximum fluorescence value providing the peak calcium response in
fluorescence. Each individual raw graph was normalized to its baseline value. The acquired
images were stored and subsequently processed offline with TillVision software (Till
Photonics, Germany).
RT-PCR
For reverse transcription (RT) of extracted RNA, 1 μg of total RNA was mixed with 1 μl of
random hexamer primer and the reaction volume was made up to 11.5 μl with addition of
DEPC-treated water, followed by heating to 65°C for 5 min, and chilled in ice. Then 4 μl of 5x
reaction buffer for reverse transcriptase, 0.5 μl RiboLock™ Nase Inhibitor, 2 μl of dNTP Mix
and 1 μl RevertAid™ H Minus Reverse Transcriptase (Fermentas, Austria) was added to the
reaction mixture. The final reaction mixture was incubated for 10 min at 25°C, followed by 60
min at 42°C and the reaction was terminated by heating to 70°C for 10 min. The reverse
transcription reaction product was directly used in PCR reaction or stored at -20°C.
For PCR reactions, 1 μl of 10 pM forward primer, 1 μl of 10 pM reverse primer, 100 ng of
cDNA and 12.5 μl of AmpliTaq Gold® 360 Master Mix (Applied Biosystems) was made up to
50 μl with addition of water. The thermal cycler protocol consisted of an initial incubation at
95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 60 s, and a
final extension at 72°C for 10 min. Sequences of primers used in RT-PCR are listed in
Supplementary Table 2. The final product was loaded in 1% agarose gel and ethidium
bromide was used for the visualization of the product along with the molecular weight
marker.
4
Quantitative RT-PCR
Real-time PCR was used for relative quantification of the C-Src and Fyn mRNA. GAPDH was
used as the reference gene (Table 1 and 2). The reactions were performed in an ABI 7700
Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR-Green
method in 10 μl reactions containing cDNA samples, 1x Mastermix for SYBR Green
(QIAGEN), forward and reverse primer .The amplification protocol was 1× (50°C, 2 min); 1×
(95°C, 6 min); 45× (95°C, 5s; 60°C, 5s; 73°C, 10s). The data for the amplification curves
were acquired after the extension phase at 73°C. After amplification, melting curves were
analyzed for the fluorescence signal. Each gene was measured in triplicate in three
independent experiments. The ∆ct values for each target gene were calculated for reference
genes using the averaged ct values by ∆ct = ctreference – cttarget formula and the silencing
was expressed as a percentage.
Immunoprecipitation for TASK-1
100 g PASMC lysates prepared in IP Buffer (20 mM Tris-HCl, 100 mM NaCl, , 1% Triton X100, 0,1% SDS, 2 mM EDTA, 1 mM PMSF, 1 mM sodium orthovanadate, 1x protease
inhibitor coctail (Roche)) were incubated overnight at 4°C with 1 μl (1ug/ml) of rabbit antiTASK-1 antibody (Abcam) or IgG as an isotype control (R & D Systems). Samples were
transferred to tubes containing 50 μl of protein A-SepharoseTM CL-4B beads (Amersham
Biosciences). After 1 h of incubation at 4°C, the immunoprecipitates were washed several
times with IP, boiled in SDS sample buffer, separated by SDS-PAGE under reducing
conditions, and transferred to a polyvinylidene difluoride membrane. Immunoblots were
analyzed using rabbit anti-TASK-1 (Abcam) mouse anti-phospho-tyrosine antibodies
(Millipore) and C-Src (Cell Signalling).
Immunoblotting
Protein extracts were prepared from hPASMCs in RIPA buffer containing Protease-Inhibitor
and Phosphatase-Inhibitor tablet (Roche, Vienna, Austria). Equivalent amounts of protein
5
were resolved on 10% SDS polyacrylamide gels and proteins were transferred to the
nitrocellulose membrane. Nonspecific antibody binding was blocked by incubation in 5%
(m/v) non-fat dry milk powder in TBST (20 mM Tris-Cl, pH 7.5, 150 mM NaCl, 0.1% (v/v)
Tween 20) at room temperature for 1 h. Afterwards, the samples were incubated overnight
with a 1:1000 diluted primary antibody at 4°C. After washing the membranes in TBST buffer
and incubating with 1:2000 diluted horseradish-peroxidase conjugated anti-IgG secondary
antibody for 1 h at room temperature, specific immunoreactive signals were detected by
enhanced chemiluminescence (ECL, Amersham, Freiburg, Germany). Anti-Src, antiphospho-Src,
anti-nonphospho-Src
antibodies
were
obtained
from
Cell
Signalling
Technology Inc.
Immuno co-localization
hPASMCs grown on glass slides were treated in SMC medium at 37°C under either
normoxic or hypoxic (5% O2) conditions for 15 min. Reactions were stopped by addition of
4% paraformaldehyde in PBS for 20 min. Fixed cells were permeabilized with 0.1% BSA,
0.5% Triton-X100 in PBS for 30 min, then rinsed five times in PBS followed by blocking with
3% BSA in PBS for 1 h. Then the cells were stained overnight with mouse anti-Src (1:100) or
mouse anti-phospho-Src (1:100) for detect the phosphorylation at Tyr419 or mouse anti-nonphospho-Src (1:100) for detect the phosphorylation at Tyr530 and rabbit anti-TASK-1 primary
antibody (1:100) at 4°C followed by incubation with anti-rabbit Alexa Fluor 488-labelled
secondary antibody (1:500) and anti mouse Alexa Fluor 596 (1:500) for 1 h at room
temperature. Cells were counterstained with DAPI to identify nuclear DNA. Duplicates were
processed without primary antibodies for controls. Analysis of the staining was made with a
confocal laser scanning microscope (LSM Zeiss Axiovert 200M). Images were taken with x60
oil immersion objective with 1.4 N/A.
Hypoxic treatment of hPASMCs
6
The effect of hypoxia in the patch–clamp and calcium imaging studies was studied by
switching between normoxic and hypoxic perfusate reservoirs. Normoxic solutions were
equilibrated with 21% O2, and 79% N2. Hypoxic solutions were achieved by bubbling with 5%
O2, and 95% N2 for at least 20 min before cell perfusion. These procedures produced pO2
values in the experimental chamber of 140–160 mmHg (21% O2) and 35–44 mmHg (5% O2).
O2 levels were measured with a GemPremier3000 blood gas analyzer from samples taken
directly from the experimental chamber containing the PASMC during perfusion, which
allows an exact measurement of pO2. By the use of a small recording chamber (200 μl), high
perfusion rate (2–3 ml/min), and short dead space, bath exchange could be achieved in <30
s.
The hypoxic treatment of PASMC (5% ambient oxygen) for phosphorylation studies
(immuno-localization and immunoblots) were carried out in the XVIVO hypoxic work station
from Biospherix (BioSpherix, Lacona, NY, USA) using fully-integrated incubators and work
station with dynamic programmable hypoxic and non-condensing humidity control at 37°C.
Solutions used in these studies were equilibrated and kept in the hypoxic work station.
Isolated, perfused, and ventilated mouse lungs
Lungs from adult C57BL/6 mice (Harlan Laboratories, Inc) were removed from the chest
under deep anesthesia, artificially ventilated and perfused with Krebs Henseleit buffer.
Mice were deeply anesthetized with isoflurane, if requiered supported with intraperitoneally
medetomidin (0,25 mg/kg body weight) and ketamine (40 mg/kg body weight), and
anticoagulated with heparin (1000 U/kg) by intravenous injection. Animals were then
intubated via a tracheostoma and ventilated with a pre-mixed gas (21% O2 5.3% CO2,
balanced with N2; positive pressure ventilation, 250 μl tidal volume, 90 breath/min and 2
cmH2O positive end-expiratory pressure). Midsternal thoracotomy was followed by insertion
of catheters into the pulmonary artery and left atrium. Using a peristaltic pump (ISM834A
V2.10, Ismatec, Glattbrugg, Switzerland), buffer perfusion via the pulmonary artery was
initiated at 37°C and a flow of 1 ml/min Pressures in the pulmonary artery and the left atrium
7
were registered via small diameter catheters (Hugo Sachs Elektronik, March-Hugstetten,
Germany). During surgery, the lungs were ventilated with positive pressure. After placing the
catheters, the artificial thorax was closed and the lungs were ventilated with negative
pressure (VCM ventilator module/PLUGSYS device in combination with the artificial thorax
type 839 (Hugo Sachs Elektronik, March-Hugstetten, Germany).. For inspiration, negative
pressure was adjusted to result in a tidal volume of ∼250μl. End-expiratory pressure was held
constant at −2 cmH2O. A breath frequency of 90 per minute was used with 50% inpiration
time. A deep inspiration was performed every 4 min with −20 cmH2O.
8
Online Supplementary Table 1. Primers used for quantitative real-time
PCR[1,2,3]
Target gene
Sequence 5’ → 3’
c-Src
GGGTAGCAACAAGAGCAAGC
GAGTTGAAGCCTCCGAACAG
Fgr
GGACTGCAGGTACTCGAAGG
AACTACATTCACCGCGACCT
Yes
TATGGCTGCTCAGATTGCTG
TTCAGGAGCTGTCCATTTGA
Lyn
TGTGAGAGATCCAACGTCCA
TTTGCTTTCCACCATTCTCC
Fyn
TGAACAGCTCGGAAGGAGAT
GGTTTCACTCTCGCGGATAA
Lck
CTTCCCCACTGCAAGACAAC
GCCACCGTTGTCCAGATTAC
TASK-1
CGGCAAGGTGTTCTGCATG
CAAGGTGTTGATGCGCTCG
GAPDH
CGTCATGGGTGTGAACCATG
GCTAAGCAGTTGGTGGTGCAG
9
Online Supplementary . Table 2. Sequence of siRNA used for the silencing[1,3]
Target gene
Sequence 5’ → 3’
TASK-1
UCACCGUCAUCACCACCAUdTdT
AGUGGCAGUAGUGGUGGUAdTdT
C-Src
UUCGGAGGCUUCAACUCCUdTdT
AGGAGUUGAAGCCUCCGAAdTdT
Fyn
AGAUGCUGAGCGACAGCUAdTdT
UAGCUGUCGCUCAGCAUCUdTdT
Non silencing
AGGUAGUGUAAUCGCCUUGdT dT
CAAGGCGAUUACACUACCUdTdT
10
Online Supplementary Figure 1.
(A)Predicted phosphorylation sites in human TASK-1. (B) Immunoblot of TASK-1 and
SrcTK from cell lysate of hPASMCs.
Online Supplementary Figure 2.
siRNA mediated silencing efficiency of C-Src and Fyn in primary hPASMC. Silencing
efficiency was checked by expression of mRNA level using quantitative RT-PCR in primary
hPASMC after 48 hours transfection with siC-Src and siFyn.
Online Supplementary Figure 3.
Effect of the inhibition of protein kinase C, protein kinase A and AMP-activated kinase
on the hypoxia-induced inhibition of TASK-1 current (IKN) in primary hPASMCs.
Representative recordings of IKN in control cells (A) and in cells treated with inhibitors of
(B,C) PKC (Ro-31-8220, Gö6983), (D) PKA (KT5720), and (E) AMP-activated kinase blocker
(compound C) under control and hypoxia.
11
References
1. Olschewski A, Li Y, Tang B, Hanze J, Eul B, Bohle RM, Wilhelm J, Morty RE, Brau ME,
Weir EK, Kwapiszewska G, Klepetko W, Seeger W, Olschewski H. Impact of TASK-1 in
human pulmonary artery smooth muscle cells. Circ Res. 2006;98:1072-1080.
2. Werdich XQ, Penn JS. Src, fyn and yes play differential roles in VEGF-mediated
endothelial cell events. Angiogenesis. 2005;8:315-326.
3. Ding Q, Stewart J,Jr, Olman MA, Klobe MR, Gladson CL. The pattern of enhancement of
src kinase activity on platelet-derived growth factor stimulation of glioblastoma cells is
affected by the integrin engaged. J Biol Chem. 2003;278:39882-39891.
12