Molecular phylogenetics and taxonomic issues in dragonfly systematics (Insecta: Odonata) Rasmus Hovm¨ oller

Molecular phylogenetics and taxonomic issues in
dragonfly systematics (Insecta: Odonata)
Rasmus Hovmöller
Department of Zoology
Stockholm University
2006
Molecular phylogenetics and taxonomic issues
in dragonfly systematics (Insecta: Odonata)
Doctoral dissertation 2006
Rasmus Hovmöller
Department of Entomology
Swedish Museum of Natural History
PO Box 500 07
SE 104 05 Stockholm Sweden
[email protected]
ISBN 91-7155-282-0
c
2006
Rasmus Hovmöller
Typeset in Computer Modern with LATEX 2ε .
Cover illustration by Andrea Klintbjer
Sympetrum sanguineum (Müller, 1764)
Printed by US-AB, Stockholm
List of papers
I: Hovmöller,, R., Källersjö, M. and Pape, T., 2004. The Palaeoptera
problem: basal pterygote phylogeny inferred from 18S and 28S rDNA
sequences. Cladistics 18, 313–323.
II: Hovmöller, R. and Johansson, F., 2004. A phylogenetic perspective on larval spine evolution in Leucorrhinia (Odonata: Libellulidae)
based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phylogenetics and Evolution 30, 653–662.
III: Hovmöller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera,
Coenagrionidae) established from COII and 16S sequences. Manuscript.
IV: Hovmöller, R. A catalog of species group names in the genus
Coenagrion Kirby, 1890 (Odonata: Coenagrionidae). Manuscript.
V: Hovmöller, R. A proposal to conserve the name Calopteryx Leach,
1815 over Agrion Fabricius, 1775. Manuscript.
i
ii
Contents
1 Clades and classification of the Odonata
1.1 Origin and monophyly of Odonata . . . . . . . .
1.2 Classification and taxonomy - a historical review
1.2.1 Pioneers of dragonfly systematics . . . . .
1.2.2 Cladistic morphological studies . . . . . .
1.2.3 Molecular studies . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
1
1
1
2
3
4
2 Life
2.1
2.2
2.3
2.4
2.5
2.6
2.7
history
Larval stage . . . . . . . .
Emergence . . . . . . . . .
Imago . . . . . . . . . . .
Mating system . . . . . .
Mating rituals and species
Ovipositing . . . . . . . .
Life on the wing . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
7
7
8
8
8
9
10
11
3 Extant clades of Odonata
3.1 Zygoptera - damselflies . . . . . . . . . . . .
3.1.1 Calopterygoidea . . . . . . . . . . .
3.1.2 “Lestinoidea” . . . . . . . . . . . . .
3.1.3 Coenagrionoidea . . . . . . . . . . .
3.1.4 Hemiphleboidea . . . . . . . . . . .
3.2 Epiprocta: Anisoptera + “Anisozygoptera”
3.2.1 The paraphyletic Anisozygoptera . .
3.3 Anisoptera . . . . . . . . . . . . . . . . . .
3.3.1 “Aeshnoidea” . . . . . . . . . . . . .
3.3.2 Cordulegastroidea . . . . . . . . . .
3.3.3 Libelluloidea . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
13
13
13
13
14
14
14
15
15
16
16
17
4 Odonata – a key group in insect evolution
4.1 History of insect flight . . . . . . . . . . . . . .
4.2 Paranota – a terrestrial origin? . . . . . . . . .
4.3 An aquatic origin? . . . . . . . . . . . . . . . .
4.4 Palaeopterous and neopterous wings . . . . . .
4.5 Folding wings – a key event in insect evolution
4.6 Palaeoptera – monophyletic or not? . . . . . . .
4.6.1 The Metapterygota hypothesis . . . . .
4.6.2 The Opistoptera hypothesis . . . . . . .
4.6.3 A monophyletic Palaeoptera? . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
19
19
20
20
21
21
21
21
22
22
5 Ribosomal sequences in phylogenetic systematics
5.1 Structure and function of the ribosome . . . . . . .
5.2 Establishing homology in molecular data . . . . . .
5.3 Approaches to multiple sequence alignment . . . .
5.3.1 Finding an optimal path . . . . . . . . . . .
5.4 Multiple sequence alignment . . . . . . . . . . . . .
5.4.1 Heuristic multiple alignment . . . . . . . .
5.5 Optimization methods . . . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
25
25
26
26
26
27
27
28
. . . . . . .
. . . . . . .
. . . . . . .
. . . . . . .
recognition
. . . . . . .
. . . . . . .
iii
.
.
.
.
.
.
.
.
.
.
.
.
.
.
5.6
5.5.1 Parsimony direct optimization – an example . . . . . . . .
Secondary structure alignment . . . . . . . . . . . . . . . . . . .
6 A presentation of the articles
28
29
31
7 Sammanfattning på svenska
7.1 Inledning . . . . . . . . . . . . . . . . . . . . . . . . . . .
7.2 Trollsländors liv och naturhistoria . . . . . . . . . . . . .
7.2.1 Klassificering av trollsländor – en historisk översikt
7.3 En trollsländas livscykel . . . . . . . . . . . . . . . . . . .
7.3.1 Larvstadiet . . . . . . . . . . . . . . . . . . . . . .
7.3.2 Förvandlingen . . . . . . . . . . . . . . . . . . . .
7.3.3 Imagon – den fullbildade sländan . . . . . . . . . .
7.3.4 Parningssystemet . . . . . . . . . . . . . . . . . . .
7.3.5 Parningsspel och artigenkänning . . . . . . . . . .
7.3.6 Äggläggning . . . . . . . . . . . . . . . . . . . . . .
7.3.7 Flyg- och jaktbeteende . . . . . . . . . . . . . . . .
7.4 De nu levande trollsländornas diversitet . . . . . . . . . .
7.4.1 Zygoptera . . . . . . . . . . . . . . . . . . . . . . .
7.4.2 Epiprocta . . . . . . . . . . . . . . . . . . . . . . .
7.4.3 Anisoptera - äkta trollsländor . . . . . . . . . . . .
7.5 En nyckelgrupp i insekternas evolution . . . . . . . . . . .
7.5.1 Vingutveckling på land – paranotalhypotesen . . .
7.5.2 Vingutveckling i vatten – omformade gälar? . . . .
7.6 Palaeoptera och Neoptera . . . . . . . . . . . . . . . . . .
7.6.1 Är Palaeoptera en monofyletisk grupp? . . . . . .
7.7 Ribosomala DNA-sekvenser i fylogenetisk systematik . . .
7.7.1 Ribosomers struktur och funktion . . . . . . . . .
7.8 Presentation av artiklarna . . . . . . . . . . . . . . . . . .
8 Acknowledgments
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
37
37
37
37
39
39
39
39
40
40
40
40
41
41
41
42
42
43
43
44
44
45
45
47
51
iv
Preface
Dragonflies (Odonata) are one of the instantly recognizable groups of insects.
The aerial acrobatics of the true dragonflies, the shimmering wings of the demoiselles and perhaps even the tiny damselflies are a familiar sight to anyone who
has spent an afternoon at a lakeside. Dragonflies are an ancient group of insects,
and a key group in understanding the evolution of insects and insect flight.
I have studied dragonflies from different phylogenetic perspectives – from the
wide view of the systematic placement of dragonflies in the insects, to higherlevel phylogeny in Coenagrionid damselflies and a close look at a small group of
libellulids in the genus Leucorrhinia. For these papers, I have used molecular
methods to obtain phylogenetic hypotheses. In addition to phylogentic studies, I have examined the nomenclature of two groups of damselflies, first in a
synonymic catalog of the genus Coenagrion and next in an examination of the
history and taxonomic availabilty of the genus name Agrion.
The first and second chapters of the introduction are about the natural history of dragonflies and how their phylogeny and life-history evolution has been
interpreted. This is followed by a presentation of the extant groups of dragonflies on a super-familial level. The final historical chapter is a history of insect
flight. Next, there is a section on ribosomal genes and different strategies for
homologizing DNA data in phylogenetic systematics, and finally a presentation
of the five articles included in this thesis.
v
vi
Chapter 1
Clades and classification of
the Odonata
1.1
Origin and monophyly of Odonata
Dragonflies are one of the most ancient groups of insects alive today. The first
known fossils of dragonfly-like insects are from the Upper Carboniferous and
belong to the group Protodonata, the extinct sister group of modern Odonata.
Included in Protodonata is the largest insect known to have existed: Meganeuropsis permiana Carpenter, 1939. This species had a wingspan of over 70
cm. Most Protodonata are only known from wings, but a composite picture
can be assembled from fragmented evidence (Grimaldi and Engel, 2005): an
insect with some striking similarities to modern dragonflies bearing toothed
mandibles, large compound eyes and legs angled forward. They were most certainly predators. Although the larvae are unknown, the close relationship to
extant dragonflies suggests that they could have been aquatic.
True Odonata appeared in the early Permian era, represented by the extinct
suborders Protanisoptera, Protozygoptera as well as the species Permagrion
falklandicum Tillyard, 1928, which has been interpreted either as a modern zygopteran or a representative of the extinct suborder Archizygoptera (Trueman in
Silsby, 2001). Modern dragonflies (Odonata sensu stricto) are a well-supported
monophyletic group (e.g. Rehn, 2003; Trueman, 1996; Kristensen, 1975; Wheeler
et al., 2001). They share several unique characters, most notably the secondary
male genitalia and the prehensile labial mask of the larvae.
1.2
Classification and taxonomy - a historical review
Figure 1.1: Scandinavian besman scale. Illustration from “Nordisk Familjebok”
(1905).
Dragonflies were originally classified in the genus Libellula within the order
Neuroptera (Linnaeus, 1758). Libellula means “small weighing scale”, referring
to a type of counterbalanced hanging scales. The linnaean Neuroptera contained
all the insect orders with multiple crossveins in the wings: Odonata in Libellula; Ephemeroptera in Ephemera; Trichoptera in Phryganea; Plecoptera, Neu1
roptera sensu stricto, and Megaloptera in Hemerobius, Mecoptera in Panorpa
and Rhaphidioptera in Rhaphidia. Fabricius (1775) divided the genus Libellula intro three: Libellula, Aeshna and Agrion. An even finer division of the
European genera was suggested by Leach (1815), where such familiar taxa as
Lestes, Calopteryx (as Calepteryx ), Gomphus and Cordulegaster were described.
Leach’s taxonomy was accepted and expanded upon by the francophone odonatologists Rambur (1842) and de Sélys-Longchamps (e.g. 1850, 1872, 1876).The
Belgian entomologist Baron Michel Edmond de Sélys-Longchamps, can be considered the founder of modern odonatology. From 1840 to his death in 1900,
he published monographs on every major group of Odonata except the Libellulidae. He described over 1000 species as well as erecting, as subfamilies, most
of the groups now treated as families. Well into the 20th century Odonata
were still usually treated as part of the Neuroptera sensu Linnaeus, although
this was often considered an unnatural grouping. In contemporary literature,
Odonata were sometimes referred to as Paraneuroptera, and grouped with the
other hemimetabolous “Neuroptera” i.e. Ephemeroptera, Psocoptera and Plecoptera in the Pseudoneuroptera. The classification changed when Martynov
(e.g. 1925) reconsidered the group Subulicornes, proposed by Latreille (1807)
for Neuroptera with tiny bristle-like antennae and aquatic larvae, under the
name Palaeoptera. This was to be a controversial group, as will be explained
below.
1.2.1
Pioneers of dragonfly systematics
Coenagrionoidea
Lestoidea
Calopterygoidea
Epiophlebia
Figure 1.2: Munz (1919) phylogeny for Zygoptera
The most notable pre-cladistic phylogenetic studies of the Odonata were
performed by Needham (1903) on the entire group, and Zygoptera by Munz
(1919). These were mostly based on patterns in the wing venation and the
theory that “ontogeny recapitulates phylogeny” (Haeckel, 1866). In Odonata
larvae, the growth of tracheae in the wing pads can be followed throughout the
instars. The pattern of the growing tracheae follow the pattern of the main
veins in the imago, but there are indications that the trachaetion as well as the
venation rather follows lacunae in the epidermis that form well before either
tracheae or veins migrate in (see Carpenter (1966), for a review).
Needham’s (1903) paper used comparative examinations of the wing-vein
patterns to extract “trends” in odonate evolution. All character states were
divided into an ancestral- (e.g. fore and hind wings alike), and a derived state
(e.g. fore and hind wings differentiated). Needham stated that there is a dichotomy between Anisoptera and Zygoptera. Anisoptera are further divided
into Libellulidae (modern Libelluloidea) and Aeshnidae (the remainder of the
Anisoptera), with Aeshnidae considered representing a primitive branch. Zygoptera are in turn divided into Calopterygidae (Calopterygoidea) and other
Zygoptera lumped into Agrionidae. Needham (1903) also discusses the peculiarities of the extant Anisozygopteran Epiophlebia superstes (de Sélys-Longchamps,
1889) (as Palaeophlebia), including its affinity to certain fossil groups, but he
2
leaves it unplaced in the genealogy.
Munz (1919) also argued for a dichotomy between Zygoptera and Anisoptera,
where the Agrionidae (Calopterygoidea in modern taxonomic terms) are a grade
including a monophyletic Coenagrionidae (the remainder of the Zygoptera).
Zygoptera are seen as being derived from Anisozygoptera.
Fraser’s (1957) reclassification of Odonata was based on the unpublished
work of Tillyard, who left an unfinished manuscript behind at his passing away
in 1937. In this landmark paper, the first phylogenetic hypothesis of the entire
Odonata was published. In Fraser’s interpretation (contrary to Tillyard’s as in
his unpublished manuscript), Zygoptera are a paraphyletic group. To a modern
phylogenetic systematist, it looks not quite like a cladogram, and one should
be careful in interpreting groups as mono- or paraphyletic. Fraser based named
groups on “persistent archaic characters”, or in cladistic terms: plesiomorphies.
Several of the families are presented as less and less primitive grades towards final families where the ancestral line reaches its highest degree of advancement.
For example, Coenagrionidae are presented as the apex of a grade consisting
of (in turn) Platystichtidae, Protoneuridae and Platycnemididae. In the figure below, I have attempted to re-interpret Fraser’s phylogeny from a cladistic
perspective.
Coenagrionoidea
Lestoidea
Calopterygoidea
Anisozygoptera
Aeshnoidea
Cordulegastroidea
Libelluliodea
Figure 1.3: Interpretation of Fraser’s tree (1957).
1.2.2
Cladistic morphological studies
As late as in 1996 was the first formal cladistic study on Odonata published
in John Trueman’s modestly titled “A preliminary cladistic analysis of odonate
wing venation”. Here 14 fossil and 32 extant Odonata were scored for 96 wing
characters; along with Palaeodictyoptera as outgroup. Trueman used an “exemplar approach”, and used only single species as terminal taxa. On the superfamilial level, Trueman’s tree holds a surprise: the rare Australian damselfly
Hemiphlebia mirabilis de Sélys-Longchamps, 1877, placed in its own superfamiliy Hemiphlebioidea, appear as the sister taxon of all extant Odonata. All
other superfamilies except Libelluloidea are found to be paraphyletic. Zygoptera
are a paraphyletic grade, leading to a monophyletic Epiprocta, including a pa3
raphyletic Anisozygoptera and a monophyletic Anisoptera. Epiophlebia is basal
to all of Anisozygoptera and are hence the sister taxon to the entire Anisoptera.
Zygoptera
Epiophlebia
Anisozygoptera
Aeshnoidea + Cordulegastroidea
Libelluliodea
Hemiphlebia
Figure 1.4: Trueman’s tree (1996).
To date, the most ambitious study on Odonata phylogeny was performed
by Rehn (2003). In this morphological cladistic study, the focus is on resolving
higher-level relationships in the Zygoptera. 85 terminals, representing all extant and fossil families and most subfamilies were included and coded for 122
characters. Terminal taxa were composites from several species coded to the
generic level, and the 85 terminals were the synthesis of 161 examined species.
Rehn found strong support for monophyly of extant Zygoptera as the sister
group of Epiprocta. A grade of fossil Anisozygoptera leads to a monophyletic
group of extant Anisoptera. In the Zygoptera, none of the superfamilies, as
proposed by Fraser (1957), came out as monophyletic. In Calopterygoidea,
there is a monophyletic core group of Calopterygidae, excluding a monophyletic
Aphipterygidae, nested in a paraphyletic Lestinoidea. Philoganga and Diphlebia,
sometimes both included in Amphipterygidae, sometimes in Diphlebiidae, are
found outside the core Calopterygoidea: Philoganga as sister taxon to the rest of
Zygoptera, and Diphlebia as the sister taxon to Lestinoidea + Amphipterygidae
+ Coenagrionoidea. Lestinoidea are not monophyletic in any analysis presented.
Coenagrionoidea is monophyletic, if Lestoideidae are included. This taxon was
placed in Agrioidea (=Calopterygoidea) by Fraser (1957). Hemiphlebia mirabilis
is found within the lestoid grade. The basal placement on this taxon by Trueman
(1996) was based on the absence of the arculus in the hind wings, a character
state only seen in fossil Archizygoptera. But as found by Trueman (1999), this
is a derived character state, as an arculus is occasionally found in Hemiphlebia
specimens.
Rehn (2003) concludes that this phylogeny has low statistical support, and
that he is “reluctant to suggest formal changes to the current family group
classification” and “The overall topology of Zygoptera suggests its division into
three subfamilies, one each for Philoganga, Calopterygoidea and the [Diphlebia,
Amphipterygidae, Hemiphlebia, Lestinoidea and Coenagrionoidea] clade [. . . ]”
1.2.3
Molecular studies
No comprehensive molecular study on Odonata phylogeny has been published
to date. Recent studies include the 12S rDNA phylogeny by Saux et al. (2003),
4
using 12S rDNA from 25 taxa, as well as Hasegawa and Kasuya (2006) who analyzed 16S and 28S rDNA data. Both studies found a paraphyletic Zygoptera
with a single species of Lestes as the immediate sister taxon to a monophyletic
Anisoptera. However, both studies suffer from poor taxon sampling and a narrow systematic scope. Where Saux et al. (2003) sampled 25 North American
taxa, the 32 species Hasegawa and Kasuya included were all from Japan. Currently, there are several research groups working on large scale molecular phylogenies, both in Europe and in the USA.
Coenagrionoidea
Lestoidea
Calopterygoidea
Philoganga
Libelluliodea
Cordulegastroidea
Aeshnoidea
Anisozygoptera
Epiophlebia
Figure 1.5: Phylogeny of Odonata according to Rehn (2003).
5
6
Chapter 2
Life history
A common myth is that dragonflies only live for a single day, something that
probably stems from confusing them with mayflies. The life cycle for a dragonfly
can be anything from six months in coenagrionid damselflies, up to nine years
in the rare Epiophlebia laidlawii Tillyard, 1921 (Silsby, 2001). Most of their
life is spent in the aquatic larval stage, with a final season as a winged imago.
Although the imago only spends few days to a few months on the wing, during
this time they will hunt, feed, defend a territory, mate and reproduce.
2.1
Larval stage
Immature stages of Odonata and Ephemeroptera are here referred to as larvae,
following the terminology of Westfall and May (1996) for “immature feeding
stage[s] of an insect that undergoes a major reorganization of body form when
transforming to the adult stage.” Dragonfly larvae are entirely aquatic and inhabit all kinds of freshwater habitats, from streams (e.g. Gomphidae, Calopterygidae) to lakes and ponds (e.g. Libellulidae, Coenagrionidae, Lestidae) and even
water accumulated in epiphytic plants (Pseudostigmatidae). Damselfly larvae
can be recognized by their slender build and the presence of three caudal gill
blades. These gills are highly tracheaeted and are used for extracting oxygen,
as well as for swimming. The shape and patterns of the gills are important
features in identifying damselfly larvae at the species level. The larvae of true
dragonflies are more robustly built and are never equipped with external gills.
Instead, the surface area of the rectum is folded, up to 60–80 times, to create
internal gills. This specialized area of the gut can be closed with a valve, and
muscles pump water in and out of the rectum for respiration. The pump also
works as an escape mechanism, and water can be pushed out as a jet stream
that propels the dragonfly larva away from predators.
The ecology of dragonfly larvae can usually be deduced from their shape:
ambush predators are squat and spiny to blend in with underwater vegetation,
and active hunters are slender and streamlined. Many Anisoptera carry sharp
spines on a ridge on top of the abdomen, as well as on the sides. These spines
serve as a protection against predation, and Johansson and Samuelsson (1994),
showed that the length of defensive spines is directly affected by the presence
of fish predators in the habitat.
The labium (the bottom mouth part, or lower lip) is transformed into an
ejectable mask. At rest, it is folded underneath the head with the labial palps
closed. When catching prey, the mask is ejected up to a third of the length
of the body, the palps open up like a bear trap, and in an instant the prey is
caught. The prey can be anything from small worms, mosquito larvae, other
aquatic insects, tadpoles and even small fish. This adaptation is unique in the
whole insect world, and one of the defining characteristics of the Odonata.
The larval stage lasts through several molts, usually between 8–15, a low
number compared to the Ephemeroptera, which pass through up to 50 larval
stages (Peters and Campbell, 1991), but high compared to louse flies (Diptera,
7
Hippoboscidae), where larvae immediately form puparia as soon as they are
deposited (Foote, 1991). The very first instar is known as a prolarva, and is
immotile with its legs fixed against the sides of the body. This stage is very
short-lasting, and the second instar hatches from the prolarva within a few
hours. After each molt, when the cuticle is still soft, the larvae grow by inflating
themselves with water. When the cuticle hardens, no growth is possible until
the next molt. Wing pads begin to show in the third or fourth instar and get
proportionally larger for every succeeding molt.
2.2
Emergence
A few days before emergence, the larva stop feeding, and the final molt takes
place within the larval skin, analogous to the pharate pupae found among
holometabolous insects. Damselfly larvae, and those of stream-dwelling gomphid dragonflies, emerge on flat rock surfaces near the water. Most Anisoptera
larvae climb reeds or plant stems and use their claws to attach themselves in
a vertical position before emerging. The dragonfly emerges by breaking the
dorsal surface of the head and thorax of the larval skin. It then proceeds to
crawl partially out of the shell, and waits until the legs are hardened before
emerging entirely. By first filling the body with air, and then using hydrostatic
pressure to push haemolymph into the wing veins and abdomen, the dragonfly
hatchling inflates itself to full size. The newly hatched, or teneral, dragonfly
can be recognized by the soap bubble-shimmering wings and pale coloration.
Teneral dragonflies sometimes migrate away from the source of water, to return
when they have fully matured.
2.3
Imago
The mature dragonfly’s appearance is different from the from the teneral. The
wings are no longer shimmering, and body color is deeper and darker. Some
species develop pruinescense. This is a waxy body coating, usually blue in
color, but ranging from white to purple and even red. This is most notable
in males, especially libellulids (i.e. Libellula depressa Linnaeus, 1758), where
the tenerals are very similar in color to the female, but the mature male has
an abdomen entirely covered with blue pruinescense. The mature dragonfly
will return to a source of water, usually the one it was hatched from, but longer
migrations also occur. An extreme example of a migrating species is the aeshnid
Hemianax ephippiger (Burmeister, 1839). Its usual habitats are desert areas
from the Sahara over the Middle East to India, but migrating individuals have
been found as far away as Iceland (Ólafsson, 1975). Territoriality is common in
dragonflies, and a male that takes up a territory will defend it from intruders,
especially conspecific males. Territorial behavior is the norm in Anisoptera, but
rare outside Calopterygoidea in Zygoptera. A good territory contains a perch,
for the male to rest and observe, and suitable sites for depositing eggs. This
can be a part of a riverbend, a clump of reeds or an area of open water.
2.4
Mating system
A unique feature of Odonata is the peculiar mating system. Male dragonflies
have, aside from the primary genitalia distally on the abdomen, secondary genitalia ventrally on the second and third abdominal segments. This structure has
no homologous counterpart in any other extant group of insects. The primarily apterygote hexapods (Zygentoma – silverfish, Collembola – springtails etc.)
have external fertilization: the males deposit spermatophores on the ground,
which are subsequently picked up by the females. Other pterygote insects (including Ephemeroptera) have a direct gonopore-to-gonopore mating system. In
8
Odonata, the male has to transfer sperm from the tip of the abdomen to a reservoir in the secondary genitalia. A side effect of the odonate mating system is
that every mating is dependent on female choice (Fincke, 1997). Before mating,
the male clasps the female using the anal appendages, but for a successful mating to ensue, the female has to flex her abdomen to connect with the secondary
genitalia of the male. In Zygoptera the females are grasped behind the prothorax, and in Anisoptera (and Anisozygoptera) around the back of the head.
This is known as the tandem position. The mating position, when females are
grasped by the males and the female genitalia are connected to the secondary
genitalia of the male, is called the wheel position. The structures involved in
Figure 2.1: Tandem and wheel. Redrawn from Robertson & Paterson (1981).
mating are useful in identifying species: males of closely related species can be
identified by the shape and size of anal appendages, and in Anisoptera also the
structures around the secondary genitalia. Zygopteran females can be identified
on the shape of the prothorax, and the mesostigmal plates on the metathorax.
Species of anisopteran females can be separated on structures around the genital
opening on abdominal segment 8.
2.5
Mating rituals and species recognition
Dragonflies recognize conspecifics by visual and tactile information. Pheromones are apparently not involved, as the antennae of dragonflies are underdeveloped structures compared to insects where air-borne chemicals are important
signals, such as moths and mosquitoes. In a few groups, most notably in certain
Calopterygoidea, mating is preceded by a courtship ritual, where the predominantly dark-metallic male raises his abdomen to expose the light underside and
flutters his wings. A brief courtship is also performed in some Anisoptera, but
most species tend to rely on visual clues for identifying prospective mates and
competitors. Pajunen (1964) studied the sex- and species recognition of two
closely related and sympatric Leucorrhinia species: L. dubia (Vanderlinden,
1825) and L. rubicunda (Linnaeus, 1758). Pajunen found that males rely on
the flight pattern to recognize conspecific males, and would attempt tandem
coupling with anything not exhibiting the typical male behavior. This included
erratically flying exhausted males, experimentally weighted down males and females painted in bright unnatural colors. Males of L. rubicunda were inspected
closely, more often than unmanipulated conspecifics, by males of L. dubia. In
smaller Zygoptera, visual clues are less useful, and recognition tends to rely
more on tactile information. Males will attempt tandem coupling with any damselflies fitting the size and color of females of their own species. Loibl (1958),
and Krieger and Krieger-Loibl (1958) studied sympatric species of Lestes and
Ischnura (both Zygoptera), and found that males would often attempt mating
with heterospecific females, but females would refuse mating by not assuming
the wheel position. It was also found that females would refuse mating with
conspecific males who had had their anal appendages experimentally altered.
Paulson (1974), performed an experiment where captive females of Enallagma
and Argia species (Coenagrionidae), were presented to con- and heterogeneric
males. Males did not distinguish females of their own species visually, but
showed less response towards heterospecific females. Extraspecfic matings were
prohibited by the males’ inability to grasp heterogeneric females around the
9
prothorax, and the refusal to mate by congeneric, but heterospecific females.
Paulson concluded that mechanical isolation is very important in clear winged
Zygoptera, where the coloration of females are simliar between closely related
species but the shape of male genitalia differ substantially.
Robertson and Paterson (1982), repeated the methods of Loibl (1958) and
experimentally altered the anal appendages of males of Enallgma glaucum (Burmeister, 1839) (now Africallagma), and found that females readily mated with
males who had altered paraprocts (inferior anal appendages), but refused matings with those with altered cerci (superior anal appendages). This corroborates the theory that the site for tactile discrimination in Zygoptera are the
inner grooves of the female mesostigmal plates. As revealed by scanning electron microscopy (Robertson and Paterson, 1982), the mesostigmal plates are
equipped with tactile sensilla at the sites where only the cerci of a conspecific
male will make sufficient contact. In these coenagrionid damselflies the shape
of the genitalia and mesostigmal plates vary distinctly, even between closely
related species, and females are very discriminating against males whose cerci
does not hit the right spots on the mesostigmal plates. This is in contrast to
those dragonflies that rely on visual information, such as the Leucorrhinia studied by Pajunen (1964), where altered cerci did not affect the females’ willingness
to mate. Or sympatric Calopteryx species (i.e. North American C. maculata
(Palisot de Beauvois, 1805) and C. aequabilis Say, 1839) where identification of
conspecifics is dependent on visual cues, and there are only minor differences
in the shapes of the genitalia and mesostigmal plates between species (Waage,
1975).
The Odonata mating system superficially appears to be a perfect example of
the lock-and-key hypothesis of Durfour (1844), explaining the shapes of genitalia
as matched to prevent heterospecific matings. However, observations are also
in concordance with Eberhard’s theory (1985) that sexual selection on animal
genitalia is driven by female choice. Eberhard’s theory is that evolution of odd
shapes in animal genitalia is driven by sexual selection, a red-queen race of
male behavioral and mechanical manipulation and female counter-adaptations
to resist the manipulations. If the same mechanisms for female choice are used to
discriminate between males of the same species, and to separate out males from
other species, then only these systems will be subjected to sexual selection. This
prediction fits the female choice system of the visually oriented Leucorrhinia,
the courting calopterygids (Waage, 1975) and the tactile Coenagrionidae (Loibl,
1958; Robertson and Paterson, 1982).
2.6
Ovipositing
Very soon after mating, ovipositing takes place. In some species, the couple
is still attached in the tandem position, in others, the male hovers around the
female to chase off other males attempting to elope with the ovipositing female,
or the female oviposits unattended. The ancestral state in Odonata is to deposit
eggs endophytically, i.e. inside plant matter, using a serrated ovipositor. This
behavior is found in all Zygoptera, in Epiophlebia, and in the plesiomorphic
anisopteran groups Aeshnidae and Petaluridae. An ovipositing damselfly can
stay underwater for several minutes while boring eggs into the stems of submerged plants. Not only underwater plants are used for endophytic oviposition:
Lestes viridis attaches eggs to branches of trees and bushes hanging over open
water. The eggs winter in this stage, and the larvae hatch in the spring. The
ovipositor has been lost independently in Gomphoidea and Cordulegastroidea +
Libelluloidea. In Cordulegastroidea a secondary unserrated ovipositor is formed
from the vulvar scales, and is used for depositing eggs in mud along the bottom of brooks and streams. In other Anisoptera, there are several methods of
ovipositing: Eggs can be dropped straight into the water from a perched or flying position, or a low-flying female can extrude eggs in small batches and release
them by dipping her abdomen in the water. The corduliid Epitheca bimaculata
10
(de Charpentier, 1825) deposits eggs in long gelatinous strands, similar to frogs’
eggs.
2.7
Life on the wing
Dragonflies are active visual predators, and show a number of adaptations for
hunting and capturing live prey. Legs are spiny and pointed forward at an
angle from the slanted pterothorax, forming a basket for catching and handling
prey. The compound eyes are adapted for sensing movement, and dragonflies
can be seen to investigate anything passing by in the air to decide if it is a
competitor, mate or food. Adaptation to counter the acute sight of competitors
have been investigated in the Aeshnid Hemianax papuensis (Burmeister, 1839)
by Mizutani et al. (2003), who showed that interacting territorial males use
motion camouflage to remain undetected even if they are circling around each
other at high speed. This is accomplished by the attacker matching the flight
movements of the occupant of the territory, as an objects stationary in the visual
field are percieved as immobile. By employing motion camoflage, the attacker
can get close to his opponent without being detected.
Figure 2.2: Pseudostigmatidae: Megaloprepus caeruleatus (Drury, 1782).
When it comes to feeding, dragonflies are generalists. Anything alive and
flying is seen as food. Flies and mosquitoes are the staple diet of most Odonata,
but some species have become specialist on certain type of prey. The aeshnid
Anax junius (Drury, 1770) prefers hymenoptera (Warren, 1915), especially honeybees, but will also eat moths, beetles and dipterans. The real specialists are
the helicopter damselflies (Psedostigmatidae) of Central- and South America,
who prey exclusively on spiders. These long (up to 21 cm in Mecistogaster ),
hover in front of spider webs in trees, and will carefully pluck any inhabitant.
After grabbing a spider with its front legs, the pseudostigmatid will fly backwards to a perch, and then bite the legs off the spider before consuming the
body (Corbet, 1999).
11
12
Chapter 3
Extant clades of Odonata
The extant Odonata are traditionally divided into three suborders: Zygoptera,
Anisoptera and Anisozygoptera (Fraser, 1957). Worldwide, about 6000 species
of Odonata have been formally named (Silsby, 2001), and a speculative estimate
(Tennessen, 1997), indicates that there are less than 10000 extant species of
Odonata. The number of described species is about evenly divided between
Zygoptera and Anisoptera. The names of higher taxa in this section is from
Fraser’s re-classification, but all reference to phylogeny is based on Rehn (2003),
and names of paraphyletic groups are set within quotes. All specimens are
pictured approximately lifesize.
3.1
Zygoptera - damselflies
The Zygoptera, damselflies, are characterized by their slender abdomen, the anterolaterally flattened head with widely separated compound eyes, similar shape
of fore and hind wings and a functional serrated ovipositor in females. Eggs are
deposited endophytically. Damselflies are generally weak fliers, compared to the
true dragonflies, with a few notable exceptions in the Pseudostigmatidae.
3.1.1
Calopterygoidea
The type family of this group is Calopterygidae, known as demoiselles in the
UK and jewelwings in North America. They are mostly found in habitats with
flowing water. Blue or green metallic body color is common, and many species
have tinted wings with several antenodal crossveins.
Figure 3.1: Polythoridae: Chalcopteryx rutilans (Rambur, 1842).
3.1.2
“Lestinoidea”
This group is sometimes called Lestoidea (Silsby, 2001). However, Lestoidea
is also the name of a genus within the group. Typically, the wings are petiolate, and are kept in a spread position at rest. The type family is Lestidae,
spreadwings (North America), or emeralds (UK). The Lestinoidea are not a
13
monophyletic group, but rather a paraphyletic grade between Calopterygoidea
and Coenagrionoidea. Some taxa traditionally placed in this group include the
family Lestoideidae with the three genera: Diphlebia, Philoganga and Lestoidea.
The former two are sometimes places in their own family Diphlebiidae (Davies
and Tobin, 1984). In Rehn’s analyses (2003) Philoganga is the sister taxon of the
entire Zygoptera, while Diphlebia is associated with the paraphyletic Lestinoid
grade. Lestoidea itself is found within Coenagrionoidea.
Figure 3.2: Lestidae: Lestes sponsa (Hansemann, 1828).
3.1.3
Coenagrionoidea
The Coenagrionoidea are a monophyletic group, when Lestoidea is included.
This group contains some of the smallest as well as the longest Odonata with
the coenagrionid Agriocnemis pygmaea (Rambur, 1842) no longer than 16–18
mm, and pseudostigmatids which can reach over 21 cm in length. Wings are
typically petiolate and hyaline with two antenodal crossveins. Ecologically they
are a diverse group, with Coenagrionidae breeding in still waters, such as ponds
and bogs, and Platycnemididae which inhabit brooks and streams. The unsual
Pseudostigmatidae live in rainforests, and breed in water filled tree holes and
leaf bases of epiphytic plants.
Figure 3.3: Coenagrionidae: Coenagrion puella (Linnaeus, 1758).
3.1.4
Hemiphleboidea
This groups consists of a single species Hemiphlebia mirabilis de Sélys-Longchamps, 1877, in the monotypic family Hemiphlebiidae, endemic to Australia
and Tasmania. It was feared to be extinct in the 1980s, but several healthy
colonies have been discovered in mainland Australia as well as Tasmania. As
discussed above, the Hemiphleboidea, are not basal within Odonata, or even
Zygoptera.
3.2
Epiprocta: Anisoptera + “Anisozygoptera”
In the light of recent cladistic analyses (Trueman, 1996; Rehn, 2003), Anisozygoptera have been found to be paraphyletic. Lohmann (1996), suggested the
taxon Epiprocta (referring to the structure formed by fusion of the male’s lower
14
Figure 3.4: Forewing of Hemiphlebia mirabilis (de Sélys-Longchamps, 1877).
Note the conspicuous lack of an arculus. Redrawn from Munz (1919).
anal appendages) for Anisozygoptera + Anisoptera, and I will use that terminology here.
3.2.1
The paraphyletic Anisozygoptera
Figure 3.5: Epiophlebiidae: Epiophlebia superstes (de Sélys-Longchamps, 1889).
One of two extant anisozygopterans.
Historically, the Anisozygoptera were a diverse group (Fraser, 1957; Trueman, 1996), but today only two species are extant, both in the genus Epiophlebia. As the name implies, this group blends features of Zygoptera with
Anisoptera. Epiophlebia has the robust synthorax of an anisopteran, with wings
that are zygopteran in shape but intermediate in venation. The head has widely
separated eyes, resembling those found in Gomphidae more than a typical zygopteran. The coloration of the body is of the black and yellow scheme common
in basal Anisoptera. The larvae are cylindrical, and have rectal gills, but are
unable to use them for jet propulsion. In mating, the female is grasped behind
the head, rather than the prothorax. They have a functional ovipositor and
lay eggs endophytically. Epiophlebia superstes (de Sélys-Longchamps, 1889) is
common in Japan. The other species, E. laidlawii Tillyard, 1921 inhabit Himalayan mountain streams, and has never been found below an altitude of 1800
m. Epiophlebia spp. are adapted to cold water and a cold climate. The larvae
of E. laidlawii have the longest development time found in Odonata, estimated
to 5–9 years.
3.3
Anisoptera
Although the term dragonfly is also used for the entire order, it is commonly
used as a vernacular for Anisoptera. The name refers to the dissimilar shape
of the wing pairs: the bases of the hind wings are broader then those of the
fore wings. At rest, the wings are held outwards to the sides. Anisopterans are
strong fliers and are able to hover and fly in any direction, including backwards.
The larvae are robust and use rectal gills for respiration and jet propulsion.
15
3.3.1
“Aeshnoidea”
Figure 3.6: Gomphidae: Gomphus vulgatissimus (Linnaeus, 1758).
This name covers the basal anisopteran groups Aeshnidae, Gomphidae and
Petaluridae. Gomphidae and Petaluridae retain the widely separated eyes,
while the Aeshnids have the more typical dragonfly eyes covering most of the
head. Members of this group share the ancestral color scheme, with a dark
base and brighter stripes on the synthorax and abdomen, never metallic. With
Gomphidae as an exception, the ovipositor is fully functional and eggs are deposited endophytically. The Petaluridae are considered the most ancestral of the
Anisoptera, based on wing venation characters. This group includes Petalura
ingentissima, the world’s largest dragonfly. It is not as long as some pseudostigmatids, but has a wingspan up to 16 cm.
3.3.2
Cordulegastroidea
This is a Holarctic group classified into a single family Cordulegastridae (goldenrings in the UK, spiketails in North America). They exhibit the ancestral
color scheme of the Aeshnoidea: a black body with yellow stripes. Oviposition
takes place in mud and sand in flowing water, the females using their elongated
ovipositor to stab eggs into the substrate.
Figure 3.7: Cordulegastridae: Cordulegaster boltoni (Donovan, 1807).
16
3.3.3
Libelluloidea
This is one of the largest and morphologically diverse groups in Odonata. Libelluloid are found in most types of habitats around the world. They range in
size from the gigantic chlorogomphids, with wingspans only rivaled by the Australian petalurids, to the world smallest dragonflies in Libellulidae (subfamily
Brachydiplactinae).
Figure 3.8: Libellulidae: Nannaphya pygmaea Rambur, 1842. One of the smallest anisopterans.
All types of coloration are found in Libelluloidea, from the ancestral blackand-yellow in Chlorogomphidae and Macromiidae to bright metallic greens in
Corduliidae and all possible colors within Libellulidae. Spectacular patterned
wings are also common within this group. Although Libelluloidea is a diverse
group, morphologically and ecologically, it is a well-established monophyletic
taxon. Synapomorphies include the entirely reduced ovipositor, and the shapes
Figure 3.9: Libellulidae: Libellula quadrimaculata Linnaeus, 1758.
of the triangles being different in fore and hind wings. The nominate group,
Libellulidae, contains the genus Libellula, which was the original Linnaean genus
for the entire Odonata. Pictured is Libellula quadrimaculata Linnaeus, 1758, the
nominate species in the nominate genus of the nominate family.
17
18
Chapter 4
Odonata – a key group in
insect evolution
Dragonflies are some of the most agile fliers among the insects. Their manouverability and speed are only rivaled by large robberflies (Diptera: Asilidae), who
actually hunt dragonflies. The flight mechanism is also very specialized. Other
insects mainly use their indirect wing muscles to power flight. These attach to
the body wall and work by deforming the shape of the thorax. In dragonflies,
the wings are powered by direct wing musculature which attach to the fulcrums
formed by the basal wing sclerites.
As Odonata are one of the most basal groups of winged insects, they hold
vital clues to the origin of insect flight. Are the direct wing muscles and uniqe
venation pattern an ancestral trait or a highly developed specilisation?
4.1
History of insect flight
Powered flight has originated four times in the history of life on earth: In the
insects, in pterosaurs, birds and bats. In the vertebrates, the multiple origin
of vertebrate wing is evident from how the forelimbs have been modified. In
pterosaurs, the arm is short, and the elongated fourth finger is used to stretch
out the wing membrane. In bats, the wing is formed by the webbing between
the fingers. In birds, the bones of the arm form the leading edge of the wing and
feathers, rather than the wing membrane, form the airfoil. In other arthropods,
there are no obvious homologous structures to the insect wings.
The oldest known insect wings are found in Namurian (Upper Carboniferous, 326–315 myo) fossil beds (Carpenter and Burnham, 1985). These are
fully formed structures and several can even be placed within extant groups,
including mayflies (Ephemeroptera) and cockroaches (Blattodea). However,
Engel and Grimaldi (2004), re-examined Rhyniognatha hirsti Tillyard, 1928,
from the Rhynie Chert of Scotland (Devonian Old Red Sandstone, formed 400
mya). Only fragments of mouth-parts are preserved, but by using compound
microscopy, the authors were able to show that the mandibles are clearly dicondylious and articulated in a manner only found among Odonata and Neoptera,
backdating pterygote insects by 75 million years.
No intermediary stage in insect wing evolution has ever been found, as
noted by Carpenter and Burnham (1985) “The fossil record, as presently known,
contributes nothing to our understanding of the actual origin of the insects.”
Phylogeny offers no simple leads, as the firmly established sister-group of the
pterygotes are the entirely wingless Zygentoma (Hennig, 1981; Kristensen, 1975,
etc.). Clues to the origin of insect wings have been sought in ontogeny Snodgrass (1935), palaeecology (Wigglesworth, 1963a,b), and ethology (Alexander
and Brown, 1963). These theories should be taken as they are: speculative,
untestable, more or less plausible, but usually thought provoking and an interesting read.
19
4.2
Paranota – a terrestrial origin?
Snodgrass (1935), launched the theory that wings have an origin in expanded
paranotal lobes – structures expanding from the folds of the soft body wall below
the sides of the dorsum. The evolution of wings is interpreted as a three-staged
process: 1. Three pairs of lateral flaps develop on the thorax. 2. The flaps
are utilized in gliding, enabling insects to “depart from a strictly terrestrial or
arboreal life”. 3. The flaps of the meso- and metathorax acquire motility, and
the flaps on the prothorax are lost. Alexander and Brown (1963) suggested the
original function of the thorax flaps were mating display. Sexual selection would
have driven the evolution towards larger and more prominent structures. Another proposed original function of the paranota is thermoregulation (Douglas,
1981). Extant dragonflies, as well as butterflies and other large-winged insects,
actively use their wings to adjust body temperature. Many insects bask in sunlight to increase body temperature, or position themselves to minimize the area
directly facing the sun. This can be observed in libellulid dragonflies perching
in the “obelisk position” with the body nearly vertical and the wings pointed
downward. As demonstrated by Kingsolver and Koehl (1985, 1994) selection for
higher body temperature would favor having wing pads over not having them,
and larger wing pads over smaller.
4.3
An aquatic origin?
Other scenarios imagine wings originating in an aquatic environment, and adaptation to flight through a function shift. Handlirsch (1937), argued that the
winged insects were derived from trilobites, rather than silverfish-like hexapods,
and that the ancestral wings were intersegmental gills. Kukalová-Peck has in
several publications (e.g. 1983; 1987; 1991) argued that wings evolved from
an leg-associated structure known as the epicoxa. This structure is the hypothetical junction between the pleuron (side) and dorsum (top) of the leg
bearing segments. Larvae in Ephemeroptera, perhaps the sister group to all
extant pterygotes (Kristensen, 1975; Wheeler et al., 2001; Ogden and Whiting,
2003), bear paired abdominal gills with a tracheaetion mimicking the pattern
on the developing winglets. These structures are seen by Kukalová-Peck as serially homologous to the wing pads of the meso- and metathorax. Marden and
Kramer (1994) described a scenario for evolution of flight through a function
shift: Stoneflies (Plecoptera) have aquatic nymphs, and are commonly associated with streaming water. In certain groups, a behavior called “skimming”
occurs, where imagos remain on the water surface and use their wings for locomotion without becoming airborne. This could be interpreted as a possible
intermediary stage in wing evolution, as it eliminates any useless transitional
stages. Gill pads could initially have been used as immobile sails, and with selective pressure pushing mobility, gliding and eventually powered flight. Hennig
(1981) placed Plecoptera as the sister group of all other neopterous insects, with
Palaeoptera as the monophyletic sister group of Neoptera. A possible interpretation is that having aquatic larvae and surface skimming adults is an ancestral
state in winged insects. However, as Will (1995) commented on Marden and
Kramer (1994), Plecoptera are neither phylogenetically basal in pterygote insects, nor is surface skimming an ancestral trait in Plecoptera. Will notes in
conclusion: “Surface skimming can be added to the list of feasible scenarios put
forward, but without the support of phylogeny it remains speculative.”
There are other difficulties with the aquatic origin theory (see Grimaldi and
Engel 2005, p.159 for a review): the earliest fossil freshwater insects are from the
Triassic era (Zherikhin, 2002), 100 million years younger than the first winged
insect fossils. Most insect fossils are formed in water by becoming embedded in
silts under anaerobic conditions (Carpenter and Burnham, 1985). It is unlikely
that the fossil record would be biased towards terrestrial insects accidentally
falling into water, against early protopterygotes in their natural aquatic habitat. Also the structures forming gills in extant insects are clearly not homolo20
gous ontogenically: the abdominal gills of Ephemeroptera are different from the
caudal gills and modified gut in Odonata, and the gill tufts of Plecoptera.
4.4
Palaeopterous and neopterous wings
Although the wings of palaeopterous and neopterous insects are undoubtedly
homologous, they are different in structure and function. Martynov (1925) first
divided the insects into two groups based on wing function. Most insects are
able to fold their wings flat over the abdomen at rest. This is achieved by a
muscle pulling on one of the sclerites articulating the wing against the body,
and a wing vein branching that allows for folding. All extant pterygote insects
fall into this category except Ephemeroptera and Odonata. These two groups
are unable to fold their wings back in any way, and keep them either upright
above the abdomen (Ephemeroptera and Zygoptera), or folded flat to the sides
(Epiprocta). Martynov assumed the latter to the ancestral condition and called
the group consisting of Ephemeroptera and Odonata Palaeoptera, or old wings.
This in contrast to the wing folding insects in Neoptera – new wings.
4.5
Folding wings – a key event in insect evolution
Wing folding has evolved twice in insects: once in the extinct group Palaeodictyoptera (Kukalová-Peck, 1991), and once in Neoptera. Wing folding has
also been lost in certain neopterous groups (e.g. papillionid butterflies). However, Neoptera is a firmly established monophyletic taxon, as established both
by morphology and molecular evidence (Hennig, 1981; Kristensen, 1975, 1991;
Boudreaux, 1979; Wheeler et al., 2001). The ability to fold the wings flat over
the abdomen is considered one of the most important reasons for the success
and diversity of insects. Folded wings allow for a more compact shape of the
insect, and has enabled the invasion of narrow habitats inaccessible to an insect
with large inflexible wings. The neopterous wing has also opened up pathways
for the forewings to evolve into protective covers for the flight wings. Protective
elytra have evolved many times independently in Neoptera (e.g. in Blattodea,
Orthoptera, Hemiptera and Coleoptera). If number of species is in any way
a measure of evolutionary success, then neopterous wing folding, not wings in
themselves, is the true key innovation for the diversity of insects.
4.6
Palaeoptera – monophyletic or not?
The monophyly of Neoptera has rarely been questioned, but Palaeoptera has
been a controversial group since it was first proposed by Martynov (1925). Even
if the palaeopterous condition is ancestral, is Palaeoptera a monophyletic group
or a grade towards Neoptera? There are three extant basal groups, and hence
three possible trees, and all possible solutions have been more or less convincingly argued from a morphological perspective. Interpreting the morphology on
this level has to rely on characters not involved with wings or flight, as these
characters can not be used to polarize the character states using apterygote
outgroups. The closest relatives of the pterygotes are Zygentoma, or silverfish.
Together with the Pterygota, they form the monophyletic group Dicondylia,
based among other characters on a unique adaptation in the articulation of the
mandibles. Other mandibulate arthropods have a mandible connecting to the
head capsule by a single socket, allowing a rotational movement of the mandible,
whereas the dicondylian mandible is articulated by two joints, limiting the movement to that of a hinged door. This adaptation has allowed the dicondylious
insects to exploit new sources of nutrition, as the more restricted mobility of
the mandibles also allows for greater leverage, enabling the crushing or grinding
of harder foodstuffs.
21
4.6.1
The Metapterygota hypothesis
Börner (1904), considered the Odonata to be more closely related to Neoptera than Ephemeroptera and united them in the group Metapterygota. This
group has received support from total-evidence (Kluge, 1998) studies (Whiting
et al., 1997; Wheeler et al., 2001), and from the thorough work of Kristensen
(1975, 1981, 1991), it is the grouping scheme that has the strongest support
from morphology. The characters connecting Ephemeroptera to the apterygote
hexapods involve characters in the mouthparts, the molting, musculature in
the tracheal system and the caudal filament. The dicondylious mandibles of
the Zygentoma and Ephemeroptera larvae (adult Ephemeroptera does not have
any functional mouthparts) are elongate and articulated parallel to the teeth
of the mandible, whereas Odonata and Neoptera have stouter, more triangular,
mandibles with the articulation perpendicular to the teeth.
Ephemeroptera are the only extant insects to molt after acquiring functional
wings. The larvae hatch to an immature winged stage called a subimago. This
stage only lasts for a very short time (minutes to a few hours), and the subimago
molts to the winged, sexually mature imago. This has been interpreted as
an ancestral trait, as many apterygote hexapods (and other arthropods) never
reach an imaginal stage, but continue to molt at irregular intervals throughout
their life (Snodgrass, 1935). However, the ancestral status of the subimago of
Ephemeroptera is open to interpretation as they do molt into a final imago, one
of the uniting characters of the Pterygota. No winged sexually mature insect
molt, and the apterygotes do not have a final instar. Therefore, the subimago
of Ephemeroptera can only also be considered an autapomorphy. There are indications from the fossil record that several other insect groups had one or more
subimaginal instars (Kukalová-Peck, 1978, 1991). In Kukalová-Peck’s interpretation, juveniles with articulated winglets occurred not only in Ephemeroptera,
but Odonata, Plecoptera, and even Hemiptera. From a cladistic perspective,
it seems unlikely that flying subimagos have been lost independently so many
times, and the allegedly flying nymphs of the Paleozoic are due for a thorough
independent review.
In most Odonata and many Neoptera groups, the muscles that close the
abdominal spiracles are attached directly to the abdominal spiracular sternites,
whereas they are missing in Ephemeroptera and apterygote hexapods. The
exact distribution of this character is not elaborated on by Kristensen (1981),
but it was coded as present in all Neoptera and Odonata in the morphological
matrices of Whiting et al. (1997) and Wheeler et al. (2001).
The terminal filament is an annulated process extending from the last abdominal segment. According to Hennig (1981), it is undecided if it is a synapomorphy of the true Insecta (or ectognathous hexapods), or if it is part of
the hexapod groundplan. It is present in Zygentoma, Archaeognatha, and
Ephemeroptera. It is missing in ectognathous hexapods and in Odonata. In
a few Plecoptera, a similar structure, the posteromedian gill filament occupies
the same position (Zwick, 1980), but its homology to the long terminal filament
of Ephemeroptera and apterygote ectognaths is uncertain.
4.6.2
The Opistoptera hypothesis
Boudreaux (1979) strongly argued for a sister-group relationship between Ephemeroptera and Neoptera, a grouping first proposed by Lemche (1940) as Opistoptera (and sometimes as Ophistoptera in the same publication). The strongest
similarity linking Odonata to the apterygote insects is the mating system.
Apterygote males deposit spermatophores which are picked up by the female,
whereas Ephemeroptera and neopterous insects always mate in copula, gonopore to gonopore. The mating system of Odonata, is considered a variant of the
ancestral method of indirect mating, with the secondary genitalia and active
sperm transfer as adaptations to a life away from flat ground. According to
fossil evidence interpreted by Bechly et al. (2001), Namurotypus (Protodonata),
22
did not have secondary genitalia and had a mating system with spermatophores
much like the extant apterygote insects.
4.6.3
A monophyletic Palaeoptera?
Martynov (1925) proposed a phylogenetic tree of the insects where several higher
taxa of insects were described. These included Paraneoptera, a group consisting of Hemiptera + Psocoptera + Phthiraptera, and the groupings Mecopterida
and Amphiesmenoptera in the Holometabola, groups later confirmed as monophyletic by phylogenetic studies (Whiting et al., 1997; Wheeler et al., 2001;
Kristensen, 1975). Martynov’s group Neoptera, the wing-folding insects, would
become almost universally accepted, but the Palaeoptera have remained controversial to this day.
Hennig (1981), supported monophyly of the extant Palaeoptera, listing 4
“relatively trivial” characters: the short antennae, the intercalary veins in the
wings, the fusion of the galea and lacinia in the larval maxillae, and the aquatic
larvae.
As any character involving wings or flight cannot be used to root the pterygotes using primarily wingless insects as an outgroup, they can’t tell us anything about the basal pterygote phylogeny. Wings with intercalary veins can
equally parsimoniously be interpreted as a symplesiomorphy. The short bristlelike antennae are ubiquitous in extant Ephemeroptera and Odonata, but as
shown by Grimaldi (2001), the antennae of Odonata are divided into distinct
antennomeres ending with a annulated flagellum, whereas they are simple, unsegmented structures with a simple flagellum in Ephemeroptera. There is also
fossil evidence (Bechly, unpublished) that stem-group Ephemeroptera, as well
as the protodonatan Namurotypus, had long flagellar antennae. This shows that
the short antennae of extant Palaeoptera is a derived condition that has arisen
in parallel.
Kukalová-Peck (1991, and others), list several characters that either involve
the wings or flight (see above), or are extrapolations (from fossil evidence) to an
unobserved ancestral condition involving endites and exites of the thorax and
abdominal segments.
In Whiting et al. (1997), and Wheeler et al. (2001), the phylogeny of holometabolous insects, and later, the entire hexapoda, were examined using formal
cladistic methods. Morphological and ribosomal (18S and 28S) molecular markers were used to find a phylogeny of insects. In the lower Pterygota, they relied
heavily on the characters described by Kristensen (1975, 1981, 1991). The morphological, as well as total-evidence trees showed support for the Metapterygota,
while the 18S tree found a monophyletic Palaeoptera.
23
24
Chapter 5
Ribosomal sequences in
phylogenetic systematics
Three papers in this thesis use information from ribosomal sequences. Nuclear
18S and 28S rDNA was used in “The Palaeoptera problem”, nuclear 5.8S and
the surrounding non-coding spacers ITS1 and ITS2 was used for the paper on
Leucorrhinia phylogeny, and mitochondrial 16S sequences provide most of the
support in the phylogenetic study on Ischnurinae.
5.1
Structure and function of the ribosome
Ribosomes are the organelles that translate protein coding mRNA sequences
into chains of amino acids that fold up to functional proteins. The ribosomes
consists of an RNA scaffolding encrusted with proteins. The active site in
ribosomes, where tRNAs connect to the extending amino acid chain is largely
free of protein, indicating that the RNA itself is responsible for forming the
catalytic site. This has been taken as evidence that the ribosomes are a remnant
from the “RNA world” (Gilbert, 1986), before enzymatic proteins evolved and
RNA both stored the inheritable information and carried out catalytic reactions.
In metazoans there are two distinct varieties of ribosomes: the nuclear ribosome found in the cytoplasm, the endoplasmatic reticulum and the nuclear
membrane and the mitochondrial ribosome, restricted to the insides of the mitochondrion. The nuclear ribosomes are assembled from two major parts: the
large- (LSU, or 28S) and the small (SSU, or 18S) subunit. Their mitochondrial
counterparts are the 16S and 12S subunits.
In contrast to the 16S and 12S, which are encoded from adjacent single
copy regions in the mitochondrial DNA, Nuclear Ribosomal RNA is transcribed
from repeated regions found in many copies on one or more chromosomes in
the nuclear DNA. The ribosomal repeats are transcribed as a unit of single
stranded RNA. Aside from 18S and 28S subunits, the ribosomal repeats encode
other regions of rRNA. These are the Internal Transcibed Spacers (ITS1 and
ITS2) and the 5.8S subunit. Before the ribosome is fully formed the spacers are
enzymatically removed. The 5.8S subunit is associated with the large subunit
in the mature ribosome. The DNA regions encoding ribosomal repeats are
very homogenous within a single genome, and a mechanism known as concerted
evolution (Zimmer et al., 1980) is thought to keep the copies identical.
The self-complementary nature of nucleic acids not only enables DNA to
form the double stranded helix, but allows the rRNA to fold up on itself to
a highly ordered 3-dimensional structure. The self-complementary regions are
known as “stem”, and the intermittent single-stranded as “loop”-regions. Stemregions are highly conserved compared to loop-regions, as single mutations in
a stem-region causes changes in the secondary- and tertiary structure of the
ribosome, which can have severe effects on its ability to function.
In molecular systematics, the nuclear rDNA genes have been extensively
25
rRNA Sequence (=primary structure)
GAGUAAAGUUAAUACCUUUGCUC
Secondary structure
GAGUAAAG
CUCGUUUC
stem
loop
Figure 5.1: A self-complementary structure of ribosomal RNA
used, especially small subunit (18S, or SSU) sequences e.g. for metazoa, Lipscomb et al. (1998); arthropods, Giribet and Rivera (2000); fungi, Tehler et al.
(2000); hexapods, Wheeler et al. (2001); plants, Soltis et al. (2000), but also
the 28S and the internal transcribed spacer (ITS) regions with the 5.8S gene.
The variability in selective pressure on stems and loops have proven very useful
for systematics. The highly conserved stem regions are suitable general primer
sites, to the extent that the same set of 18S PCR primers can be used for everything from fungi (Tehler et al., 2000), flatworms (Norén and Jondelius, 1999),
polychaetes (Rousset et al., 2004) as well as insects. Thus variable regions that
contain phylogenetic information on several taxonomic levels can be amplified
by general primers. The ITS regions are highly variable, but are easy to amplify
by PCR using general primers in the 3’ end of the 18S rDNA and the 5’ of 28S.
5.2
Establishing homology in molecular data
Comparing character states in homologous structures is the very basis of phylogenetic systematics (Hennig, 1966). For morphological characters, primary
homology can be established from several criteria: positional homology, ontogeny, structural similarity, etc. In molecular data, ontogeny and structural
similarity are not applicable. An adenine “A” in one position is indistinguishable from any other A. Thus positional information is the only clue for finding
homology in DNA data, a procedure referred to as alignment.
For protein coding genes, positional homology can easily be established as
the sequences have to conform to the amino acid triplet code. A single insertion
or deletion in a protein coding sequence shifts the reading frame, and often
results in a non-functioning protein, which can be lethal to the organism.
Ribosomal are less affected by insertion and deletion events, especially in
the loop regions. As a result rDNA sequences from different organisms differ in
length to the degree that positional homology is difficult to establish.
5.3
Approaches to multiple sequence alignment
Homologous regions in two DNA sequences can be visualized as a dot-plot matrix, where one sequence is represented by the X-axis and the other by the
Y-axis. Similarities between any position in one sequence to the other are
marked, showing longer stretches of matching sequence as downward diagonal
bands going left-to-right on the plot.
All possible alignments between two sequences are contained in a dot-plot,
as any path that begins in the upper right corner and ends in the lower right
represents a possible alignment.
5.3.1
Finding an optimal path
To find an optimal alignment, explicit costs for substitutions and gaps have to
be set. The costs used must follow the triangle inequality law i.e., the sum of any
two kinds of costs must be equal to or greater than any other. If substitutions
cost 1, and gaps 0, the optimal result would be an alignment without parsimony
informative characters from substitutions.
26
0
1000
0
1000
2000
Figure 5.2: A dot plot of 18S rDNA from the dragonfly Sympetrum sanguineum
(Libellulidae) and the stonefly Isoperla obscura (Perlodidae). The break in the
diagonal corresponds to a large insert in the stonefly sequence.
Needleman and Wunsch (1970), developed an algorithm to find optimal
alignments between protein amino-acid sequences. The algorithm is very general, and can be applied to any pairwise alignment problem, and is guaranteed
to find every optimal path through a pairwise alignment. The N-W algorithm
is the basis of all algorithmic multiple alignment.
5.4
Multiple sequence alignment
Although the N-W algorithm was described for solving pairwise sequence alignment, it can be expanded to finding optimal alignments for more than two
sequences. However, this rapidly becomes very computationally demanding, as
the number of possible alignments increase geometrically with the number of
sequences to align. Computationally hard problems, such finding an optimal
multiple alignment, can sometimes be broken down into several smaller problems: a multiple alignment can be re-phrased into a series of pairwise alignments.
However, this creates a new problem: you can no longer be sure to have found
an optimal alignment, as the result is dependent on the order in which the sequences are added to the multiple alignment. One method for determining the
sequence addition order is to create a guide tree.
5.4.1
Heuristic multiple alignment
A common method for creating multiple sequence alignments is the Clustal
algorithm (Higgins and Sharp, 1988), as implemented in computer programs
ClustalW (Thompson et al., 1994) and ClustalX (Thompson et al., 1997). The
Clustal algorithm is a two-stage process: pairwise and multiple alignment. In
the pairwise step, phenetic distances between all sequences are calculated. These
are used to create a guide tree for the multiple alignment stage. The first versions
of Clustal, up to ClustalV, used a simple UPGMA (Sneath and Sokal, 1973)
algorithm to create the guide tree, but later versions use a Neighbor-joining
(Saitou and Nei, 1987) method.
The limitation in Clustal is that it only examines a single guide tree, and
outputs a single multiple alignment. The only options for finding better alignments under one set of multiple alignment costs is to either examine the effects
of changing the cost settings in the pairwise alignment stage, or to use guide
trees obtained from other methods.
MALIGN (Wheeler and Gladstein, 1994), is a computer implementation of
a heuristic multiple alignment algorithm. The tenet of the MALIGN philosophy
is to use an explicit optimality criterion throughout the process of creating the
guide trees and the multiple alignment. The MALIGN algorithm is different
27
from Clustal in that it evaluates several guide trees, and keeps a tally of costs
during the multiple alignment stage. The total cost of the alignment will be
identical to the tree length if the resulting multiple alignment is analyzed under
the same cost parameters that was used in creating the alignment. MALIGN can
perform the basic parsimony heuristic searches, such as SPR, TBR and branchand-bound. The trees found during searches are used as guide trees, with MALIGN keeping track of the implied tree-length in finding the most parsimonious
multiple alignments. However, MALIGN is magnitudes more computationally
demanding than Clustal.
5.5
Optimization methods
From the tree based static alignment method implemented in MALIGN, direct
optimization methods is just a step away. These methods were introduced by
Wheeler (1996) under the bold title (although with a humble question mark)
“Optimization alignment: the end of multiple sequence alignment in phylogenetics?” Direct optimization (DO) is derived from the standard cladistic character
optimization of Farris (1970) and Fitch (1971). An explicit cost regimen is required for DO, where every allowed kind of transformation must be given a cost.
The simplest models only set costs for substitutions (DNA base to another DNA
base), and gaps (insertions and deletions). More complicated methods where
different types of substitutions have different costs, and there is a lower cost
for extending a gap than opening one etc., can also be utilized. In the Wheelerian philosophy, a cladogram can be interpreted as a computer program that
transforms one sequence to another. The events that transformed the ancestral
sequence at the node to the sequences observed in the terminal taxa can be
deduced from the topology of the tree and the explicit costs used to calculate
the tree length. DO finds the lowest total transformation costs needed for a tree
(the tree length), and standard heuristics (TBR, SPR, Ratchet) can be used to
find the tree that has the lowest total transformation costs. There is no need
ever to create a static alignment in this process.
TTT
TTG
TA
TAG
TA(G) +1 gap
TWG
+1 substitution
+1 substitution
TTK
Figure 5.3: The down-pass of direct optimization. The cost of the optimization
is calculated and preliminary ancestral states are reconstructed at the nodes
5.5.1
Parsimony direct optimization – an example
Here I will only present how the simplest parsimony model for DO works, but
several optimization methods have been presented e.g. fixed states (Wheeler,
1999), iterative pass optimization (Wheeler, 2003b) and Maximum Likelihood
(Wheeler, 2006). These methods are implemented in the computer program
POY (Gladstein and Wheeler, 2003). In the example, the optimization is a
standard ACCTRAN optimization (Farris, 1970) under Fitch parsimony (unordered character states), with equal costs (1) for substitutions and gaps. There
is a down-pass, where putative ancestral sequences are created at the nodes, and
an up-pass, where the ancestral nodes are reconstructed.
28
The down-pass
Starting at the upper right corner, the ancestral state for the sequences TA and
TAG has to be re-created. This necessitates either an insertion or deletion of a
G, so the preliminary sequence
atTTG
the node
The parenthesis indicating
TTT
TA is TA(G).
TAG
that the third base is either a G, or nothing, so the ancestral sequence was
either TAG or TA. Moving down one node, TA(G)
the +1sequence
on the next branch
gap
is TTG. The simplest way of transforming TTG to TA(G) is a substitution in
the second position. In the putative ancestral
sequence,
+1
substitution this is represented by
TWG
a W, the IUPAC code for either T or A. The third position if fixes as a G, as
+1 substitution
TTK
this state is found possible for both sequences.
The putative ancestral sequence
for this node becomes TWG. Moving further down, the final (root) node is to
be reconstructed. Transforming TTT to TWG requires one substitution in the
third position, and once again a IUPAC code (K = T or G) is used to represent
the ambiguity. In the second position, T is fixed, as it is a possibility for both
sequences, and the reconstructed root becomes TTK. The total transformation
needed for this tree has been 1 indel and 2 substitutions, for a total cost (or
tree length) of 3.
TTT
TTG
TA
TAG
TAG
TTG
TTK
Figure 5.4: The up-pass of direct optimization. Final ancestral states are reconstructed at the nodes.
The up-pass
The final cost cannot change by going through the up-pass, but this step will
finalize the reconstruction of the ancestral states at each node. This begins at
the node above the root, as the root has no ancestors. Each position in the
ancestral state will be that of the node below, if they have a possible common
character state. Comparing TTK to TWG, W is T or A, and K is T or G.
Thus the final reconstructed sequence of that node is TTG. Moving up, TA(G)
is compared to TTG. Now, the most parsimonious possible sequence has to be
assigned to the node. TA(G) could be either TAG – this would require one
substitution, or TA – this would require one substitution and an indel, so the
optimized ancestral state of this node has to be TAG, and the deletion has to
be an autapomorphy of the terminal taxon with TA.
5.6
Secondary structure alignment
It is known from proteins, as well as ribosomal RNA, that the sequence (or
primary structure) is less conserved than the secondary- (2-dimensional) or tertiary structure (the 3-dimensional shape). While the 3-dimensional structure
cannot yet be inferred from the nucleotide (or amino-acid) sequence, there are
numerous models to predict the secondary structure: the loops and stems of
ribosomal RNA, and the helices and sheets of proteins. The European ribosomal database (Wuyts et al., 1994) is an online repository of RNA sequences,
aligned after a secondary structure model. The derivation of the model is not
strictly mathematical, but an amalgam of manual comparison, theoretical models, and incremental adjustments as more ribosomal sequences become known
29
(Van de Peer et al., 1997). Methods for aligning new sequences after a secondary structure model include using the profile alignment option implemented
in Clustal (Norén and Jondelius, 1999), manual alignment with visual reference
to pre-aligned sequences (Kjer, 2004), and model-based alignment using Hidden
Markov Models (Wallberg et al., 2004). Clustal profile alignment uses an aligned
matrix to create a consensus sequence. The unaligned sequences are then aligned
to this consensus sequence following the standard Clustal algorithm, with all its
implicit problems.Wallberg et al. (2004) used a probabilistic model for sequence
alignment as implemented in the program HMMer (Eddy, 2003). This program
uses pre-aligned sequences to create a statistical model of gaps and nucleotides
(or amino-acids). The probability for each kind of nucleotide (or gap), is calculated for each position in the model. The custom model can then be applied
to unaligned sequences to create a multiple alignment. Although HMMers have
some limitations: “HMMs make poor models of RNAs [. . . ] because an HMM
cannot describe base pairs ( HMMer manual. p.7)”, this method of creating an
alignment with reference to secondary structure is repeatable, and will get better the more pre-aligned sequences are used in creating the model. However, the
“repeatable” methods for secondary structure alignment (Clustal profile alignment, HMMer), as well as the manual method, all rely on the vaguely defined
model of the European Ribosomal database. Unlike an alignment created by
MALIGN, or an implied alignment from POY, they do not use an optimality
criterion and deciding on the “best” alignment becomes a matter of aesthetics.
Phillips et al. (2000) summed up their review on multiple sequence alignment
with this cautionary message: “In many ways, alignment is where phylogenetic
analysis was 20 years ago. [. . . ] Computer programs for performing alignments are in their infancy and users are often unfamiliar with the numerical
and methodological assumptions made.” Alignment methodology is often a neglected step in systematics, compared to recreating the phylogeny. One should
never forget that this is the crucial step in which homology assessments are
made.
30
Chapter 6
A presentation of the
articles
I: Hovmöller,, R., Källersjö, M. and Pape, T., 2004. The Palaeoptera
problem: basal pterygote phylogeny inferred from 18S and 28S rDNA
sequences. Cladistics 18, 313–323.
This article originates from my undergraduate thesis ”Basal pterygote phylogeny
– a molecular study” from Stockholm University (1999). For this study, complete 18S sequences, along with a 600 bp fragment of 28S, were obtained from 18
Odonata, 8 Ephemeroptera and the archaeognathan Petrobius brevistylus Carpenter, 1913. This publication spurred a reply by Ogden and Whiting (2003).
In their rebuttal, they focused on the omission of a POY sensitivity analysis
(Wheeler, 1995), as well as not incorporating the morphological characters of
Whiting et al. (1997). In the sensitivity analysis paradigm, the best parameters for analyzing molecular data (including creating alignments) are those that
minimize incongruence among datasets (Mickevich and Farris, 1981). The most
“robust” phylogeny is the one recovered under many different parameter sets.
The reanalysis of the data from paper I, found that a monophyletic Palaeoptera
is found “only under a small (23%) subset of alignment parameters”
The figure 23% was calculated by creating Clustal alignments from 18S, 28S
and combined datasets under 11 sets of gap opening weights (1,2 and 5 -100
in 5 step increments), with gap extension either set to 1 or equal to the gap
opening cost, and then analyzing the multiple alignments with gaps either as a
5th base or missing data. It should be noted that one of the conclusions of paper
I is that 28S rDNA is not useful for finding the basal pterygote phylogeny, yet
28S only datasets accounts for 33% of these analyses. In the 18S only datasets,
either a monophyletic Palaeoptera was found (81%), or the basal phylogeny was
unresolved (19 %) with gaps treated as missing data. In combination with 28S,
and gaps as missing data, Palaeoptera remains at 81%, while exactly one set of
parameters each found an unresolved basal polytomy or Opistoptera. If gaps
were treated as a 5th state all 18S only analyses found the basal phylogeny
unresolved. A monophyletic Metapterygota or Opistoptera was never recovered
from 18S or combined 18S + 28S data, only from 28S only analyses accounting
for a total of 7%.
Ogden and Whiting (2003) also performed a combined analysis with 18S,
28S, morphology and new data from the histone 3 (H3) gene. These analyses
always found a well supported monophyletic Metapterygota. Using only molecular data, the basal phylogeny varied according to the settings, and all four
(Palaeoptera, Metapterygota, Opistoptera, and unresolved) possible outcomes
appeared.
However, in all analyses including the morphological data, Metapterygota
was always recovered. There are no natural boundaries for “reasonable” parameter sets to examine, and by carefully selecting which data to present, the
reliability of a group can be given any requested percentage. There is clearly
31
phylogenetic conflict in between the 18S data and morphology. The evidence
from 18S can only be considered inconclusive, and the other genetic markers
tested (H3, 28S) do not provide information at this taxonomic level. The case
of the Palaeoptera problem remains open.
II: Hovmöller, R. and Johansson, F., 2004. A phylogenetic perspective on larval spine evolution in Leucorrhinia (Odonata: Libellulidae)
based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phylogenetics and Evolution 30, 653–662.
Leucorrhinia Brittinger, 1856 are a group of Anisopterans, consisting of 14
(Tsuda, 2000) to 16 (Paulson et al., 2006) recognized species. The scientific
name is derived from the white frons, a plate located above the mouthparts, as
leukos is white and ris is nose in classic Greek. The common name is whiteface dragonflies in North America and white-face darters in the UK. These
dragonflies have a circumboreal distribution, i.e. they are only found on the
northern hemisphere. They prefer acidic water, and several species only breed
in Sphagnum bogs. In Libellulidae, and many other anisopteran groups, the
larvae are equipped with spines on the dorsal and lateral sides of the abdomen.
In Leucorrhinia larvae, there are species with strong spines (e.g. L. caudalis
(de Charpentier, 1840)), and those completely lacking spines (e.g. L. borealis
Hagen, 1890). Johansson and Samuelsson (1994) and Johansson (2002), showed
that the spines are effective in defense against predation from fish, and that the
length of the spines is affected by the presence or absence of fish in the larval
environment. This is an example of predator-induced phenotypic plasticity (reviewed by Benard (2004)), where the production of spines is affected by not just
genetic, but also environmental factors. One of the purposes of this study was
to obtain a reliable phylogeny of Leucorrhinia, to find the relations among the
species lacking spines. We were able to show that the spines had been reduced
at least twice: once in the Paleaarctic L. rubicunda (Linnaeus, 1758), and once
in a clade of Nearctic species.
The genetic markers used in this study are the internal transcribed spacer
(ITS) regions and 5.8S rDNA. We found evidence that concerted evolution, the
mechanism which keeps the many copies of ribosomal DNA identical throughout
the genome, has less effect over the ITSs than the rDNAs (18S, 28S and 5.8S).
This was found when the PCR products proved difficult to sequence, and no
amount of tweaking the protocols resulted in clear readings. A solution was to
clone the sequences into bacterial plasmids. Cloning is performed by ligating
the PCR product into a bacterial plasmid. The plasmids are then mixed with
E. coli bacteria with chemically disrupted cell walls, allowing the plasmids into
the cytoplasm. The bacteria are grown on a selective medium, which only
allows those cells that have taken in a plasmid to multiply. The bacteria are
spread on agar plates, where colonies stemming from a single bacterium grow.
Each colony is genetically identical, and the insert in the plasmid stems from
a single molecule in the PCR product. The result is that individual molecules
can be sequenced, even from a mixed PCR product. In every examined case,
intraindividual variation was found in the non ITSs, but rarely in the 5.8S
rDNA.
A modified sensitivity analysis (Wheeler, 1995) was used to evaluate the
topological stability in the phylogenetic trees. We tested a variety of settings
in the pairwise- and multiple alignment stages, effectually testing various guide
trees (from the pairwise step). In retrospect, this was a crude way of circumventing the limitations of the single guide tree of the Clustal algorithm.
III: Hovmöller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera,
Coenagrionidae) established from COII and 16S sequences. Manuscript.
These are the first results from an ongoing project about the phylogenetic relationships within the family Coenagrionidae. The monophyly of the family
has been doubted by recent cladistic morphological studies (O’Grady and May,
32
2003; Rehn, 2003), and the subfamilial divisions have been demonstrated to
be highly artificial. Coenagrionidae are divided into 5 subfamilies, following
pre-cladistic work by Fraser (1957). The characters involved in separating the
subgroups are mostly quantitative characters, such as the degree of petiolation:
the relative length of the narrow proximal part of the wings. In a preliminary
study involving a wider sample of coenagrionids, the only subfamily that was
resolved as monophyletic were the Ischnurinae, and I decided to focus on this
group. This is also the only group that is diagnosed by clearly defined morphological characters: the presence of a vulvar spine in females, and a raised
structure of the 10th abdominal segment in males. The placement of the groups
outside Ischnurinae proved to be unsupported by parsimony jackknifing, and
a forthcoming project is to sequence additional molecular markers to improve
stability in these parts of the tree. Two molecular markers were sequenced for
this study, both from the mitochondrial genome: 16S ribosomal DNA and cytochrome oxidase II (COII), a protein-coding gene. For the alignment of the
16S gene, I used a new method for finding better alignments than those found
by Clustal. This method uses the standard cladistic optimality criterion, where
shorter trees are preferred. Since there are frequent indels in the 16S gene, gaps
are treated as a 5th character state. Following Grant and Kluge (2003), no type
of transformational events are given higher weight than another, so all costs
(substitutions and gaps) were set to 1 in all steps. An initial alignment was produced by Clustal from the Neighbor-joining distance tree. This alignment was
entered into TNT (Goloboff et al., 2005) to find the most parsimonious trees.
Of of the most parsimonious trees was then used as a guide tree in Clustal, to
produce a new alignment, which in turn was entered into TNT etc. This iterative process resulted in trees significantly shorter than the initial tree produced
by analysis of the Clustal alignment. At the fourth iteration, the resulting trees
were longer, and the tree from the third iteration was submitted to POY to
create an implied alignment.
The use of POY to create the final alignment was indented to minimize
artifacts introduced by the Clustal algorithm. Given a tree and explicit transformation costs, POY can in a very short time (seconds in this case) generate
an implied alignment (Wheeler, 2003a; Giribet, 2005). The implied alignment
is based on the homology statements implicit from the tree. The tree length as
calculated from POY is identical to the one of the shortest trees from the static
implied alignment. This shows that almost any tree produced by a parsimony
method is an improvement over the distance based guide trees produced by
Clustal. This simple iterative process eventually yielded trees more than 10%
shorter than the initial tree. Ideally, POY could have been used to find the
shortest trees too, but the computer resources needed were not available at this
time. The 16S and COII sequences were combined and analyzed separately, as
well as in a combined analysis. Parsimony jackknifing and Bayesian inference
(Ronquist and Huelsenbeck, 2003) were used to estimate stability of the groups
in the tree.
In Ischnurinae, the two genera Ischnura and Enallagma together make up almost 50% of the 291 species recognized in the subfamily. 24 out of 29 ischnurine
genera have less than 5 species, with 13 being monotypic. One of the purposes
of this study was to find the boundaries of Ischnura and Enallagma, as several
smaller genera are likely to be ingroups within these. Ischnura was found to be
monophyletic if the monotypic genus Rhodischnura was allowed as an ingroup,
while Enallagma was never found to be monophyletic. Also, Ischnura hastata
(Say, 1893), unusual in having a pterostigma behind the wing margin, was found
to be a true Ischnura. It had previously sometimes been placed in the monotypic genus Anomalagrion. Historically, Enallagma has been used for species
in two geographically disjunct areas: the Northern hemisphere and Africa. As
was suggested by May (2002), the African Enallagma are not closely related to
the Holarctic monophyletic group. A puzzling find was that samples from two
Ischnura aurora (Brauer, 1865), a species with a wide geographical distribution
from Tahiti to the Middle East, did not group together. An investigation into
33
this using the ITS regions hints that I. aurora may be a species complex, and
could possibly be divided into several species (Dumont, pers. comm.).
IV: Hovmöller, R. A catalog of species group names in the genus
Coenagrion Kirby, 1890 (Odonata: Coenagrionidae). Manuscript.
This is a purely taxonomical study, as it does not contain any analytical findings.
However, taxonomic information is a necessity in systematics for providing the
correct names of species and locating type material and descriptions. Sources
for taxonomic information are scattered all over historical literature, and there
is no central repository for species names, descriptions and information of type
material.
One of my findings was that the species Coenagrion exornatum (de SélysLongchamps, 1872) as listed in several catalogs, simply did not exist! The
bibliographical reference for C. exornatum is found in the catalog published by
Kirby (1890), pointing to a description by de Sélys-Longchamps, 1872. Only by
checking the original 1872 description, it could be deduced that Kirby must have
accidentally changed C. ecornutum into C. C. exornatum. On the page specified,
only the description of Agrion ecornutum can be found. Errors introduced by
one catalog author are propagated by later compilers, and once in a while a
return to the sources is useful for clearing up inconsistencies and finding accurate
bibliographical data. This takes many trips to the library and emails to curators
all over the world.
V: Hovmöller, R. A proposal to conserve the name Calopteryx Leach,
1815 over Agrion Fabricius, 1775. Manuscript.
The rule of priority is one of the central tenets in nomenclature. This is the rule
that the first name imposed on a taxon (species-level or higher) should be used
for that group and cannot be replaced by a younger synonym. However, sometimes older names are forgotten, or fall into disuse even if they formally have
priority. For this reason, the International Commission of Zoological Nomenclature (ICZN), is an instance of appeal for when zoologists notice that there
is a need to suppress a formally senior name when a junior name is in such
prevailing usage that a reversal would threaten taxonomic stability. In the case
of Agrion and Calopteryx, this was an old disagreement that was never formally
settled. In this case, Kirby (1890) is once again one of the culprits!
When Kirby wrote his catalog of Odonata, there were no formal published
rules on zoological nomenclature. Kirby was a strong enthusiast of the rules of
priority, and devised new names for taxa whenever he thought the senior name
could be threatened. Thus the usage of the name Calopteryx Leach, 1815 and
Agrion Fabricius, 1775 were radically changed. Latreille (1810), had indicated
Agrion virgo Linnaeus, 1758, as type species for the genus Agrion Fabricius,
1775. At this point in time, only the genus Agrion was recognized in the entire
Zygoptera. Leach (1815) described the new genus Calepteryx for “Agrionida
with coloured wings”, as well as the genus Lestes. The naming scheme with
using Agrion for Coenagrionoidea, Lestes for Lestidae and Calopteryx for, well,
Calopterygids was used by most of the important odonatologists of the 19th
century. Kirby decided to apply the rules of priority strictly, and reverted the
Calopterygids to Agrion and devised the new taxon Coenagrion for the species
at that time usually called Agrion. The result was confusion about which group
should really be called Agrion. In the debated that followed, the usage of Agrion
was clearly an emotional issue.
Erich Schmidt (1948) raised the question if the name changes introduced
by Kirby added to, or reduced, nomenclatural confusion: “ [. . . ]why should I
use Agrion, when the arguments offered for the change are in no way indisputable? If I continue to use Calopteryx, as hitherto in all my published papers,
I am sure to be understood correctly at once, and this is the principal matter.” A (harsh) reply from Cynthia Longfellow came the following year: “How
exceedingly tiresome of Dr. Erich Schmidt to have again raised the question
34
of ‘Calopteryx versus Agrion’, and on insufficient knowledge.” Citing the rules
of priority, Longfellow concluded “The case for Agrion versus Calopteryx is
clearly proved and all Dr. Schmidt’s arguments are useless.” In Schmidt’s rebuttal (ibid.), he resorts to hoping for a decision against Latreille’s genus types
by the “God-like International Commission of Zoological Nomenclature”, but
“[. . . ]this is only a dream of the future. However, the present generation has a
duty to establish an accord in nomenclature as soon as possible [. . . ] especially
for the younger generation, in order to prevent, in the end, football versus entomology.” In 1954, everyone seemed to have settled down when Montgomery
wrote a very thorough paper on “Nomenclatural confusion in the Odonata; The
Agrion-Calopteryx problems.” This article delves deeply into the etymology of
the Greek behind the names Calopteryx and Agrion, and the correct form for the
family named after the latter genus (it should be Agrionidae, rather than Agriidae or Agrioidae). This is followed by a careful examination of the literature
and the finding that Agrion does have priority over Calopteryx. This conclusion
has been accepted, but not applied by later authors. In recent faunistic literature (Westfall and May, 1996; Askew, 1988), the issue is recapitulated with the
conclusion that using Agrion would be formally correct, but using Calopteryx
is actually less confusing.
I found that the issue had never been formally settled, although a manuscript
written by Montgomery (1955) to conserve Agrion was widely circulated but
never published (Garrison, pers. comm.). I drafted this manuscript as an appeal to the ICZN, formulated according to their specifications. It is currently
circulated among odonatologists, as to avoid stirring up a hornet’s nest like
Erich Schmidt!
Figure 6.1: Calopterygidae: Calopteryx virgo (Linnaeus, 1758).
35
36
Kapitel 7
Sammanfattning på svenska
Trollsländor tillhör de insekter som är lättast att känna igen. Deras skickliga
manövrar i luften, de skimrande vingarna hos jungfrusländor och kanske även
de små flicksländorna är en bekant syn för den som tillbringat en sommareftermiddag vid en sjö. Trollsländor är en av de äldsta grupperna av nu levande
insekter, och en nyckelgrupp i insekternas naturhistoria och utvecklingen av
insektsvingar.
7.1
Inledning
Avhandlingen sammanfattar den forskning jag har utfört vid Naturhistoriska
riksmuseet 2001–2006. Den inkluderar fylogenetiska studier över trollsländornas
släktskap ur olika perspektiv, samt rent taxonomiska avsnitt där jag av nomenklaturorsaker har gjort djupdykningar i arkiven för att reda ut vilka namn som
är giltiga inom flicksländesläktet Coenagrion och vilket vetenskapligt namn som
är det rätta för jungfrusländorna: Agrion eller Calopteryx.
7.2
Trollsländors liv och naturhistoria
Trollsländor används som namn för hela ordningen Odonata, men ibland också
specifikt för gruppen Anisoptera. Här använder jag “trollsländor” för hela Odonata, “äkta trollsländor” för Anisoptera samt “flick- och jungfrusländor” för
Zygoptera.
De äldsta fossilen av trollsländelika insekter är från övre karbon och hör
till ordningen Protodonata, en utdöd grupp som är trollsländornas historiskt
närmaste släktingar. Till denna grupp hör Meganeuropsis permiana som med
ett vingspann på över 70 cm är den största insekt som funnits. De äldsta fossilen
är mestadels avtryck av vingar, men från dessa är det känt att Protodonata
var mycket trollsländelika insekter. Inga larver har hittats, men det är fullt
möjligt att de var akvatiska. Äkta trollsländor har hittats bland fossil från perm,
huvudsakligen representerade av utdöda grupper men även ett vingfragment
som kan ha kommit från en flickslända av nutida typ har påträffats.
7.2.1
Klassificering av trollsländor – en historisk översikt
Trollsländorna placerades av Linné i ett enda släkte, Libellula, inom ordningen
Neuroptera. Namnet Libellula betyder “liten våg” och syftar på en gammaldags
besmanvåg. Linné placerade alla insekter med tvärribbor i vingarna i denna ordning, som innehöll alla de insektsgrupper med efterleden –sländor: dagsländor,
trollsländor, bäcksländor, stövsländor, nattsländor och skorpionsländor samt de
nätvingeartade (Neuropteroida) insektsordningarna (äkta nätvingar, ormhalssländor och sävsländor). Eftersom den linnéanska ordningen Neuroptera visade
sig vara en onaturlig grupp av insekter som inte var närmare släkt med varand37
ra, och de övriga “sländorna” har placerats i egna ordningar, omfattar numera
ordningen Neuroptera bara gruppen äkta nätvingar.
Den förste att dela upp trollsländorna i mindre grupper var Fabricius, som
1775 bröt upp Linnés Libellula i tre släkten: Aeshna för mosaik-, flod- och
kungstrollsländor, Agrion för flick- och jungfrusländor, samt Libellula för segeloch guldtrollsländor.
Trollsländor fortsattes att betraktas som en del av Neuroptera långt in på
1900-talet, trots att man var medveten om att det var en onaturlig gruppering.
Ibland fördes de ihop med de övriga “sländor” som har ofullständig förvandling,
dvs. dagsländor, bäcksländor och stövsländor, i gruppen Pseudoneuroptera, eller
som en självständig ordning i Paraneuroptera.
Betydande förkladistiska studier över trollsländornas fylogeni utfördes under det tidiga 1900-talet av Needham och Munz, samt senare även Fraser. Under denna tidsperiod utgick man mycket från Haeckels teori om att ontogenin
upprepar fylogenin – en organism upprepar stadier dess förfäder genomgått under evolutionshistorien i sin embryonalutveckling. Ett populärt exempel var de
gälbågar och simhud som finns under en kort tid under fosterutvecklingen hos
däggdjur. Hos trollsländelarver kan man se hur vingribbnätet anläggs genom
ådror som växer in i vinganlagen från kroppssidan. Man utgick ifrån att de
ribbor som anlades först var de mest ursprungliga, och genom att studera utvecklingen av vingribbsnätet genom larvstadierna slöt man sig till vilka drag som
var primitiva respektive avancerade. Senare har det visat sig att utvecklingen av
vingribbor, såväl som de ådror med kroppsvätska som finns i vingarna, snarare
följer de hålrum, lakuner, som bildas i vinganlagen långt innan vingribbor eller
kroppsvätskeådror växer in.
Needham jämförde trollsländor släktesvis för att upptäcka mönster i gruppens evolution. Karaktärstillstånd klassificerades som antingen primitiva (framoch bakvingar likformade), eller avancerade (fram- och bakvingar olikformade). Needham, liksom Munz, tycke sig kunna se en tvådelning i utvecklingen av
trollsländorna mellan Zygoptera och Anisoptera.
Fraser gjorde ett banbrytande arbete i sin reklassificering av hela Odonata. Han gick noggrant igenom vingkaraktärer, men utgick fortfarande från
tänkandet i utvecklingslinjer när han ritade ett släktträd över ordningen Odonata. I detta träd ligger familjegrupper som stationer på en tunnelbanekarta, med den mest avancerade familjen som slutstation. Till exempel måste
flicksländetåget passera Platystichtidae, Protoneuridae och Platycnemididae innan det kan nå fram till fulländing i Coenagrionidae. Fraser ansåg att Zygoptera
inte var en enhetlig grupp, utan innehöll arter som via en gradvis utveckling
nådde de äkta trollsländorna.
Den första större kladistiska översikten av trollsländesystematiken kom så
sent som 1996. Då publicerade australiensaren John Trueman sin morfologiska
studie baserad på vingkaraktärer från 32 nutida och 14 fossila arter. Han fann
också att flick- och jungfrusländorna utgjorde en parafyletisk (icke-naturlig)
grupp. En överraskning var att den den sällsynta flicksländan Hemiphlebia mirabilis, endemisk för Australien och Tasmanien, visade sig vara systertaxon till
hela övriga Odonata!
Rehn (2003) publicerade en mycket ambitiös studie över ordningen Odonata. Denna studie fokuserade på släktskapsförhållandena mellan större grupper
inom flick- och jungfrusländor och baserades på morfologi, men inte bara från
vingkaraktärer. Rehn fann, att flick- och jungfrusländor utgjorde en naturlig
systergrupp till Epiprocta som innehåller de äkta trollsländorna samt de som
placerats i den parafyletiska gruppen Anisozygoptera. Ett viktigt resultat var
att klassificeringen i överfamiljer bland flick- och jungfrusländor visade sig vara
baserad på icke-naturliga grupper.
38
7.3
En trollsländas livscykel
En vanlig missuppfatting är att trollsländor bara lever en enda dag, någonting
som förmodligen kommer ifrån en sammanblandning med de mycket kortlivade dagsländorna. Livscykeln hos en trollslända varierar mellan ett halvår för
vissa små flicksländor upp till de nio år utvecklingen kan ta hos den sällsynta
trollsländan Hemiphlebia laidlawii. Den längsta delen av livscykeln utgörs av
larvstadier, med en sista säsong som fullbildad flygande insekt. Trots att den
flygande trollsländan endast lever några dar till några månader så hinner de
jaga byten, försvara ett revir och para sig under denna period.
7.3.1
Larvstadiet
Yngelstadier hos de insekter som inte har fullständig förvandling (med larv,
puppa och imago) brukar kallas nymfer, men trollsländors yngelstadier brukar
även de kallas larver, och jag följer den terminologin här. Ett äldre namn som
aldrig slog igenom för vattenlevande insektsnymfer är najader. Vackert, men
lika bortglömt som Linnés yrfän som svenskt ord för insekter. Trollsländelarver lever i alla slags sötvatten, från strömmande vatten till sura mossar, sjöar
och små dammar. Flick- och jungfrusländelarver känns igen på den smäckra
kroppsbyggnaden och de tre bladgälarna i bakkroppsspetsen. Larverna hos äkta
trollsländor är mer kraftigt byggda och saknar helt yttre gälar. De förlitar sig
på en veckad gältarm för syreupptagning. Vatten kan pumpas ut och in genom
anus, och genom att snabbt pressa ut allt vatten ur tarmen kan trollsländelarver
förflytta sig korta sträckor genom jetdrift! Detta har förmodligen utvecklats som
ett sätt att undfly rovdjur som andra större vatteninsekter och fiskar.
Trollsländelarvers ekologi återspeglas i kroppsformen. Lurpassare är satta
och taggiga, medan aktiva jägare är avlånga och strömlinjeformade. En unik
anpassning hos trollsländelarver är fångstmasken. Denna består av ett omformat labium, den understa mundelen hos insekter, med en gångjärnsled och två
rörliga palper. I hopfällt tillstånd ligger den vikt under huvudet, med de tandade palperna täckande större delen av ansiktet. När ett byte skall fångas kastas
fångstmasken ut, och palperna slår igen som en rävsax. Byten utgörs av små
vattendjur som maskar, mygglarver och grodyngel. Trollsländor genomgår totalt 8-15 larvstadier. De kan bara växa i storlek mellan skalömsningar, något
de gör genom att pumpa upp sig själva med vatten innan den nya huden ännu
inte hunnit hårdna till ett skal. Vinganlag börjar anas som små flikar i omkring
tredje eller fjärde larvstadiet. De blir proportionerligt större för varje ömsning.
I det sista larvstadiet kan vingribbmönstren hos den fullbildade sländan anas i
de halvgenomskinliga vinganlagen.
7.3.2
Förvandlingen
Ett par dagar innan den akvatiska delen av livscykeln avslutas slutar larven att
äta, och den sista ömsningen sker inuti larvskalet. Larven kryper sedan upp på
land för att fullborda förvandlingen, på ett vasstrå eller en klippa. Ömsningen
sker genom att skalet spricker upp över ryggen och huvudet, och trollsländan
kryper ut med huvud och mellankropp först. När benen har härdat i luften drar
den ut bakkroppen ur skalet. Den nyömsade trollsländan blåser upp sig själv till
full storlek genom att fylla kroppen med luft och sedan pressa ut kroppsvätska
i vingribborna och bakkroppen. En nyömsad trollslända känns igen på de bleka
färgerna och på att vingarna skimrar som såpbubblor.
7.3.3
Imagon – den fullbildade sländan
Nyömsade trollsländor ger sig ibland av från vattnet tills de blivit könsmogna.
De återvänder för det mesta till det vattendrag där de kläcktes, men kan även
göra längre förflyttningar. Ett extremt exempel är mosaiktrollsländan Hemianax
ephippiger som normalt lever i ökenområden i Nordafrika och Mellanöstern, men
39
har hittats så långt bort som på Island, där det inte förekommer några inhemska
trollsländearter.
7.3.4
Parningssystemet
Bland insekterna har trollsländor ett helt unikt parningssystem. Hanar har
förutom de primära könsorganen i bakkroppsspetsen sekundära könsorgan på
undersidan av de andra och tredje bakkroppssegmenten. Denna struktur har
ingen motsvarighet hos någon annan insektsgrupp, och är svårtolkad ur ett evolutionärt perspektiv. De vinglösa insekterna (som silverfiskar och hoppstjärtar)
har extern befruktning – hanar deponerar en spermatofor direkt på marken
och denna plockas upp av honan utan att någon egentlig parning sker. Övriga
vingade insekter har intern befruktning där parningen sker könsöppning mot
könsöppning. Hos trollsländor förflyttar hanen sperma från bakkroppsspetsen
till en reservoar i de sekundära könsorganen. Vid parningen använder hanen
sina cerci (bakkroppsspröt) för att greppa honan, antingen bakom huvudet (hos
äkta trollsländor), eller runt mellankroppens första segment (flick- och jungfrusländor). Honan måste sedan böja sin bakkropp upp mot hanens sekundära
könsorgan för att parningen skall slutföras. Både de primära och sekundära
könsorganen hos trollsländor är viktiga karaktärer för artbestämning: även hos
arter som är ytligt sett mycket lika finns det små men distinkta skillnader i
dessa strukturer.
7.3.5
Parningsspel och artigenkänning
Trollsländor förlitar sig på synen och känseln för att känna igen artfränder.
I ett fåtal grupper, som jungfrusländor, föregås parningen av ett parningsspel
där hanen fladdrar med vingarna och visar upp den ljusa undersidan av bakkroppsspetsen. Hos äkta trollsländor sker artigenkänningen helt genom visuella
signaler. Hanar av kärrtrollsländor, Leucorrhinia, tolkar flygstilen hos andra
trollsländor, och uppvaktar allting som inte flyger som en hane av samma art.
Bland flicksländor är känselsignaler viktiga för artigenkänningen. Hanar försöker
ofta para sig med individer av annan art, men lyckas då inte få grepp runt
det första mellankroppssegmentet. I de fall där hanen lyckas gripa en hona av
annan art sker ofta ingen parning. På undersidan av det andra mellankroppssegmentet finns en mesostigmalplatta som är försedd med strategiskt placerade
känselborst. Endast hanar av artfränder har bakkroppsspröt som passar och
träffar rätt känselborst. Om inte rätt borst berörs av hanen vägrar honan att
böja upp bakkroppen mot hanens sekundära könsorgan och genomföra parningen.
7.3.6
Äggläggning
Mycket kort tid efter parningen lägger honan sina ägg. Detta sker ibland medan
paret är hopkopplade i tandem. Det ursprungliga tillståndet hos trollsländor
är att lägga äggen inuti växtmaterial, så kallad endofytisk äggläggning. Hos
alla flick- och jungfrusländor, samt de ursprungligaste grupperna bland äkta
trollsländor har honan en sågtandad äggläggare som snittar små hål i växter
där äggen läggs ett och ett. I de grupper där äggläggaren har förlorats läggs
äggen i öppet vatten, eller borras ner i dy eller sand. En udda metod finns
hos guldtrollsländan Epitheca bimaculata där äggen läggs i geléartade strängar,
liknande grodrom.
7.3.7
Flyg- och jaktbeteende
Kroppen hos en trollslända har många anpassningar för ett liv som aktivt jagande rovdjur. De stora fasettögonen är anpassade för att upptäcka rörelse mer
än för att känna igen målbilder av byten. Mellankroppen är vinklad framåt så
att de taggiga benen bildar en fångstbur för att gripa och hålla fast bytet. Mundelarna består av ett par kraftiga mandibler som river bytet i mindre delar, och
40
ett par syllika maxiller som håller det i ett stadigt grepp. När det gäller dieten
är trollsländor generalister, men flugor och mygg utgör stapelfödan. Ett fåtal
grupper has specialiserat sig, som helikopterflicksländorna (Pseudostigmatidae)
i Syd- och Mellanamerika som är specialister på att äta spindlar. De svävar
fram mot spindelnät i träd och plockar skickligt innehavaren. Sedan flyger de
baklänges bort från nätet. När de landat, knipsar de först av benen på spindeln
innan de äter upp kroppen.
7.4
De nu levande trollsländornas diversitet
Traditionellt delas trollsländor in i Zygoptera (flick- och jungfrusländor), Anisoptera (äkta trollsländor) samt Anisozygoptera (saknar svenskt namn). Det
finns ca 6000 beskrivna arter av trollsländor, och en gissning är att det finns
färre än 10000 totalt.
7.4.1
Zygoptera
Flick- och jungfrusländor känns igen på den smala kroppen, det framifrån tillplattade huvudet med utstående brett skilda fasettögon och nästan likformade
fram- och bakvingar. De är för det mesta svaga flygare och förflyttar sig sällan
längre sträckor.
Calopterygoidea
Typfamiljen i denna grupp är Calopterygidae, jungfrusländor. De lever vanligen
i strömvatten och hanarna uppvaktar honor med parningsspel. Kroppen är ofta
blå- eller grönmetallisk, och vingarna är mörkfärgade.
“Lestinoidea”
Detta är en parafyletisk grupp som inte är baserad på några enkla karaktärer.
Vingarna är vanligen avsmalnande mot kroppen och hålls något utslagna när
sländan sitter stilla. Smaragdflicksländorna, Lestes och vinterflicksländan Sympecma fusca hör hit.
Coenagrionoidea
Inom denna grupp finns såval de minsta flicksländorna som de allra längsta
helikopterflicksländorna (Pseudostigmatidae), vilka kan ha en bakkroppslängd
över 21 cm. Ekologiskt är det en divers grupp. Vanligast är larvutveckling i stillastående vatten, men även strömmande vatten utnyttjas av flodflicksländorna
(Platycnemididae). De udda helikopterflicksländornas larver lever i vattenfyllda trädhål och epifytiska ananasväxter. Vingarna hålls vid vila ihopslagna över
bakkroppen.
Hemiphleboidea
Denna grupp innefattar en enda art, den lilla sällsynta Hemiphlebia mirabilis,
endemisk för Australien och Tasmanien. Den har betraktats som mycket primitiv, eftersom den saknar den innersta tvärslån i vingen, arculus, något som finns
hos alla andra trollsländor men saknas hos utdöda grupper. Det har senare visat
sig att detta är en sekundär förlust hos Hemiphlebia, eftersom ett par procent
av alla individer trots allt har en utveckad arculus.
7.4.2
Epiprocta
Detta är en sammanslagning av den parafyletiska gruppen Anisozygoptera och
den monofyletiska gruppen Anisoptera. Karaktären som förenar gruppen är att
de undre bakkroppsspröten, paraprocterna, har smält samman.
41
Den parafyletiska gruppen Anisozygoptera
Historiskt var Anisozygoptera en artrik grupp, men nu finns endast två levande
representanter, båda i släktet Epiophlebia. Dessa ser ut som en felande länk mellan Zygoptera och Anisoptera. De har ögon som sitter brett åtskilda, men till
formen är Anisoptera-artade. Mellankroppen är kraftigt byggd, som hos Anisoptera, men vingarna är likformiga som hos Zygoptera. En fungerande äggläggare
finns. Larverna är byggda som Anisopter-larver, men saknar förmågan till jetdrift. Av de två arterna är Epiophlebia superstes vanlig på de Japanska öarna,
men Epiophlebia laidlawii förekommer endast på över 1800 m höjd i Himalaya.
7.4.3
Anisoptera - äkta trollsländor
Namnet syftar på de olikformade fram- och bakvingarna. De senare är bredare
och har ofta en skarp vinkel vid basen. De äkta trollsländorna är skickliga flygare
och kan sväva i luften och flyga i alla riktningar, även baklänges. Larverna är
kraftiga och kan förflytta sig korta sträckor med jetdrift. Vid vila hålls vingarna
brett utslagna åt sidorna.
“Aeshnoidea”
Detta namn täcker de ursprungligare trollsländefamiljerna Aeshnidae, Gomphidae och Petaluridae. Gomphidae (flodtrollsländor) och Petaluridae har behållit
de ursprungliga separerade fasettögonen medan Aeshnidae (mosaiktrollsländor)
har mer typiska trollsländeögon som täcker nästan hela huvudet. De har alla
den ursprungliga färgskalan, med svart bottenfärg och ljusare ränder på mellanoch bakkroppen. Äggen läggs endofytiskt förutom i Gomphidae.
Cordulegastroidea
Kungstrollsländorna, Cordulegastridae, är den enda familjen i denna holarktiska grupp. De har den ursprungliga svart-gula färgskalan som aeshnoiderna.
Honorna har en sekundär äggläggare som används för att borra in ägg i dy och
sand i strömmande vatten.
Libelluloidea
Denna monofyletiska grupp uppvisar en stor del av den morfologiska variationen
inom de äkta trollsländorna. Libelluloider finns i alla typer av vatten över hela
jorden. Storleksmässigt varierar de mellan jättarna i familjen Chlorogomphidae
(med vingspann upp till 15 cm) och den knappt tumslånga Nannophyopsis clara
i Libellulidae. Alla typer av färger förekommer, och mönstrade vingar är vanligt.
Inom denna grupp finns släktet Libellula, som var Linnés ursprungliga släkte för
alla arter som nu ingår i ordningen Odonata.
7.5
En nyckelgrupp i insekternas evolution
Vingar och aktiv flygning har uppstått fyra gånger under evolutionen: hos insekter, flygödlor, fåglar och fladdermöss. Bland ryggradsdjuren är det uppenbart
att vingarna har uppstått flera gånger oberoende av varandra eftersom de har
bildats från olika strukturer. Hos flygödlorna hölls vingmembranet uppe av ett
förlängt finger, hos fladdermöss av huden mellan fingrarna och hos fåglar bildas
vingframkanten av benen i armen och vingytan av fjädrar. Hos ryggradsdjuren
är det också lätt att förstå varifrån vingarna utvecklades, eftersom de alla är modifierade framben. Bland övriga leddjur finns det ingen självklar motsvarighet
till insekternas vingar.
De äldsta insektsfossilen har hittats i 400 miljoner år gammal röd sandsten
i Rhynie, Skottland. Ett av dessa fossil, Rhyniognatha hirsti består endast av
fragment från mundelar. Fossilet hittades 1925, men en ny undersökning har
visat att mundelarna liknar de som endast finns hos trollsländor och högre
42
vingade insekter. Detta tyder på att vingarna utvecklades tidigt i insekternas
historia. Det har inte hittats något mellansteg i utvecklingen av vingar i fossil, där de antingen saknas helt eller är fullt utvecklade flygdugliga vingar av
modern typ. Det finns inte heller några ledtrådar att hämta från fylogenin, eftersom systergruppen till de vingförsedda insekterna är de fullständigt vinglösa
fjällborstsvansarna. Mer eller mindre trovärdiga teorier om vingarnas uppkomst
har framlagts inom utvecklingsbiologi, etologi, morfologi och palaeoekologi. De
skall tas för vad de är – intressanta hypoteser, mer eller mindre trovärdiga och
tankeväckande, men trots allt spekulationer.
7.5.1
Vingutveckling på land – paranotalhypotesen
Snodgrass lanserade i sitt standardverk om insektsmorfologi teorin om att vingflikar uppstått som genom en utvidgning av den mjuka kroppsväggen mellan
sidoplåtarna och ovansidan av mellankroppssegmenten. Ovansidan av ett mellankroppssegment hos insekter kallas notum, och paranota betyder “vid sidan av
notum”. Den ursprungliga funktionen skall ha varit glidflygning, och rörlighet
och muskulatur något som utvecklats senare. Ett annat förslag på den ursprungliga funktionen är att vingflikarna användes för parningsspel. Sexuell selektion
skall sedan ha drivit dem mot större och större strukturer. Även värmereglering
har föreslagits som en ursprunglig funktion för vingflikar, och det har bevisats
experimentellt att även små vingflikar skulle ge ett betydligt värmetillskott som
kunde öka rörligheten hos en liten insekt.
7.5.2
Vingutveckling i vatten – omformade gälar?
Andra hypotes om vingarnas uppkomst är att de har utvecklats i sötvatten
och ursprungligen haft en annan funktion än flygning. Ett förslag som lagts
fram är att vingar har sitt ursprung i en ben-associerad struktur kallad epicoxa.
Detta är ett helt hypotetiskt segment, som är resultatet av en extrapolering från
fossil och nutida leddjur hur det ursprungliga leddjursbenet såg ut, och vilka
segment som ingick. I denna modell är de gälar som finns längs bakkroppen hos
dagsländenymfer en motsvarighet till vingar, vad gäller position i segmentet och
ursprunglig funktion. Insektsvingar blir också genom den hypotetiska epicoxan
jämförbara med de bengälar som finns hos vissa kräftdjur. Hos vissa bäcksländor
förekommer ett beteende som kallas “skimming”, något som jag i brist på bättre
motsvarande begrepp kallar surfning. Bäcksländenymfer är vattenlevande, och
de fullbildade sländorna håller alltid till nära vattendrag. Surfningen innebär
att den nykläckta bäcksländan använder vingarna som segel, utan att någonsin
lämna vattenytan. Gälblad skulle ursprungligen varit icke-rörliga strukturer som
använts som segel, och selektionen skulle gynnat större, rörligare och till slut
flygdugliga strukturer. Hypotesen of surfning som ett förstadium till flygning
har dock inget som helst stöd i fylogenin. Bäcksländor är inte en basal grupp
bland högre vingade insekter (Neoptera), och de arter som surfar är inte basala
inom ordningen bäcksländor. Det rör sig snarare om en anpassning till ett liv i
en mycket kall miljö, där vingmusklerna inte blir tillräckligt varma för att lyfta
insekten.
Det finns andra skäl att tveka om trovärdigheten i att vingar utvecklats i vatten. De äldsta fossila sötvattensinsekterna är 100 miljoner år yngre än de äldsta
vingade insektsfossilen. De flesta av de äldsta insektsfossilen är från landlevande
insekter, men fossiliseringen har skett i vatten genom att insekterna bäddats in
i lera under syrefattiga förhållanden. Varje landlevande insekt som fossiliserats
i vatten måste ha hamnat där genom olyckshändelser. Om flygande insekter utvecklats i en akvatisk miljö verkar det osannolikt att fossillagren i sjösediment
domineras av landlevande insekter. Även morfologiskt är det tydligt att gälar
hos vattenlevande insekter har utvecklats ur olika strukturer. Trollsländornas
bladgälar och gältarm motsvaras inte av dagsländornas bakkroppsgälar eller
bäcksländornas gältofs i bakkroppsspetsen.
43
7.6
Palaeoptera och Neoptera
Vingarna hos insekter är homologa strukturer, och de vingförsedda insekterna
(Pterygota) utgör en naturlig grupp. Om vingar finns, uppträder de i samma
position: mellankroppens andra och tredje segment. De flesta insekter kan vika
vingarna platt över bakkroppen när de inte flyger; de enda insektsgrupper som
helt saknar denna förmåga är trollsländorna och dagsländorna. Ovikbara vingar sågs som någonting primitivt, och gruppen som utgörs av dagsländor och
trollsländor fick namnet Palaeoptera – gamla vingar. De vingvikande insekterna
sågs som mer avancerade och placerades i Neoptera – nya vingar. Förmågan att
vika vingarna över bakkroppen är en av de viktigaste anpassningarna i insekternas evolution. Vikbara vingar har möjliggjort för insekter att invadera trånga
mikrohabitat som skulle trasa sönder stora stela palaeoptervingar. Vingvikning
har även bäddat för omformning av framvingar till täckvingar, som skyddar de
ömtåliga flygvingarna. Skyddande täckvingar har uppstått parallellt hos exempelvis kackerlackor, tvestjärtar och skalbaggar. Om antalet arter är ett mått
på evolutionär framgång så är det vikbara vingar, och inte vingar i sig, som är
nyckeln till diversiteten inom insekterna.
7.6.1
Är Palaeoptera en monofyletisk grupp?
Eftersom det finns tre basala grupper (Odonata, Ephemeroptera och Neoptera),
så finns det tre möjliga fylogenier, varav alla tre har haft sina välformulerade
förespråkare. Ett bekymmer är att karaktärer i vingarna, eller strukturer associerade med flygning inte kan användas för lösa Palaeoptera-problemet. Anledningen är, att det är omöjligt att upptäcka vilket karaktärstillstånd som är det
ursprungliga, eftersom vingar helt saknas hos de närmaste släktingarna. Det går
inte att avgöra om ovikbara vingar är en anpassning som förenar trollsländor och
dagsländor i en monofyletisk grupp, eller om det är det ursprungliga tillståndet
för en flygande insekt.
Metapterygota: Odonata + Neoptera
En av de karaktärer som håller ihop gruppen är formen på mandiblerna. Hos
fjällborstsvansar och dagsländenymfer (fullbildade dagsländor saknar helt fungerande mundelar) är mandibeln långsträckt och mest rörlig parallellt med
mandibelns tänder. Hos Odonata och Neoptera är mandibeln kraftig och triangulär och rörlig mer som ett gångjärn. En mer tveksam karaktär är förlusten
av subimagostadiet. Primärt apterygota insekter når aldrig ett sista utvecklingsstadium, de blir könsmogna när de nått en viss storlek och fortsätter sedan att ömsa skal med ojämna mellanrum hela livet. Dagsländenymfer kläcks
till ett kortlivat sub-imagostadium, som efter ett par timmar ömsar skal till
det slutgiltiga könsmogna imagostadiet. Inga andra insekter ömsar skal efter det att de har utvecklat flygdugliga vingar. De som förespråkar Metapterygota ser dagsländornas sub-imagostadium som en rest av det ametabola
ömsningssystemet hos de vinglösa insekterna. Men eftersom de vinglösa insekterna aldrig når ett imagostadium kan sub-imagostadiet lika gärna ses som en
unik anpassning hos dagsländorna. Andra karaktärer som föreslagits är de muskler som stänger andningsöppningarna på bakkroppen och förlusten av ett långt
ringlat spröt på sista bakkroppssegmentet.
Opistoptera: Ephemeroptera + Neoptera
Den starkaste karaktären som förenar de två grupperna Ephemeroptera och Neoptera är parningssystemet där spermieöverföringen alltid sker könsöppning mot
könsöppning. Här ses trollsländornas unika parningssystem som en sekundär anpassning till ett liv som inte levs som hos de apterygota insekterna, på marken.
Ett fossil av Namurotypus från den utdöda gruppen Protodonata tyder på att de
första trollsländeartade insekterna inte hade sekundära könsorgan utan hade ett
parningssystem med spermatoforer liknande det hos de apterygota insekterna.
44
Ett monofyletiskt Palaeoptera?
Karaktärer som anförs för ett monofyletiskt Paleoptera är de korta antennerna,
sekundära längsribbor i vingarna, sammansmältningen av två mundelar och de
akvatiska larverna. Vid en närmare gransking är de korta borstlika antennerna
hos trollsländor och dagsländor inte särskilt lika varandra. Trollsländeantenner
är uppdelade i segment, medan de hos dagsländorna har en enkel struktur utan
tydliga segmentgränser. Det finns dessutom fossil som antyder att ursprungliga
dagsländor, såval som den trollsländelika Namurotypus hade långa trådlika antenner. Detta visar att de korta antennerna hos nutida Palaeoptera har uppstått
parallellt.
I nyare studier har morfologiska karaktärer och DNA-sekvenser analyserats
för att hitta en stabil insektsfylogeni. För de ursprungligare flygande insekterna har fanns ett starkt morfologiskt stöd för Metapterygota, medan molekylärinformationen gav ett svagare stöd för Palaeoptera. När alla data analyserades tillsammans, en så kallad “total-evidence”-analys, hade de morfologiska
karaktärerna en starkare genomslagskraft än den molekylära informationen.
7.7
Ribosomala DNA-sekvenser i fylogenetisk systematik
De tre fylogenetiska studierna i denna avhandling bygger alla på information
från ribosomala DNA-sekvenser. 18S och 28S användes i “The Palaeoptera
Problem”, ITS-sekvenser i artikeln om Leucorrhinia och mitokondriella 16Ssekvenser bidrar med det mesta av upplösningen till fylogenin över Ischnurinae.
7.7.1
Ribosomers struktur och funktion
Ribosomer är de organeller i cellen som bygger upp proteiner genom att översätta
den genetiska koden i mRNA (messenger-RNA) till en kedja av aminosyror. Hos
djur finns det två typer av ribosomer, de som är associerade med kärnan och
cellplasman, och de som endast finns inuti mitokondrier. Kärnribosomen byggs
upp av två subenheter: 18S och 28S. De mostsvaras i de mitokondriella ribosomerna av 12S och 16S. Varje subenhet består av ett RNA-skelett insprängt med
proteiner. Den del av ribosomen som sammanfogar aminosyror saknar nästan
helt proteinkomponenter, och kan vara en rest av livet före DNA, när RNA både
lagrade den genetiska informationen och skötte katalys av biokemiska reaktioner.
Kärnribosomernas RNA-skelett byggs upp utifrån mönster i DNA-sekvenser i
“ribosomala paket”. Paketen innehåller den komplementära DNA-koden för de
ribomala subenheternas RNA-skelett, men även regioner som inte bygger upp
ribosomen. Ribosomalt RNA i de ribosomala paketen transkriberas (översätts)
från DNA i ett stycke. Därefter klipps de mellanregioner som inte ingår i subenheterna bort från RNA-kedjan innan subenheterna sammankopplas till en ribosom. Ribosomala paket finns i många kopior på flera av kärnans kromosomer,
och en biofysisk mekanism antas hålla alla kopiorna identiska genom hela genomet.
Komplementära strukturer
Liksom DNA bildar en dubbelspiral kan RNA bilda strukturer genom självkomplementaritet. Genom självkomplementaritet byggs ribosomens tredimensionella struktur upp av de förbindelser som bildas mellan olika regioner i ett och
samma RNA-kedja. De segment som är komplementära till ett annat är också
mycket känsligare för mutationer, eftersom en förändring as sekvensen riskerar
att orsaka en icke-fungerande ribosom. Detta medför att ribosomalt DNA består
av omväxlande variabla- (icke-komplementära) och konserverade regioner.
I molekylärsystematisk forskning har ribosomala DNA-sekvenser använts
för att utreda fylogenin inom så vitt skilda grupper som gröna växter, svampar,
leddjur och även för stora analyser av hela djurriket.
45
Homologi i molekylära data
Att jämföra karaktärstillstånd är själva grunden för fylogenetisk systematik. För
morfologiska karaktärer är det i regel inte svårt att avgöra om karaktärerna i
sig är homologa i de organismer som undersöks. För DNA finns det inga motsvarande ledtrådar. Ett adenin-A ser exakt likadant ut som vilket annat A.
Nukleotider i DNA är endast jämförbara om de har samma relativa position i
DNA-sekvensen.
För proteinkodande gener är DNA-sekvensen uppbyggd av tripletter som
motsvaras av aminosyror i proteinet. Om en DNA-bas skulle läggas till eller försvinna så fasförskjuts översättningen till protein vilket resulterar i ett
oanvändbart enzym. Därför varierar proteinkodande sekvenser mycket lite i
längd mellan organismer, vilket gör det lätt att hitta den positionala homologin.
Ribosomala gener regleras inte av tripletter. Det medför att DNA-baser lättare
kan plockas bort eller läggas till genom mutationer, och är mycket svårare att
homologisera.
Jämkning av DNA-sekvenser
När DNA-sekvenser från olika arter varierar i längd är den positionella homologin för varje enskild DNA-bas osäker. En metod för att hitta homologin är
jämkning av sekvenserna, vilket innebär att “gap”, representerade av ett “-”
sätts in för att fylla ut de positioner där baser förlorats eller motsvaras av en
insertion. Den metod som är grunden för alla typer av beräknad jämkning är
Needleman-Wunsch (N-W) algoritmen. Med den kan man enkelt hitta en optimal jämkning mellan två sekvenser, så kallad parvis jämkning. N-W algoritmen
kan utökas för att hitta en optimal jämkning av fler sekvenser än två. Antalet
antalet beräkningar som krävs ökar geometriskt med antalet sekvenser, och en
expanderad N-W är därför praktiskt oanvändbar för mer än ett fåtal sekvenser
samtidigt.
Ett matematiskt svårt problem som jämkning av många sekvenser kan delas
upp i en serie av parvisa jämkningar, men då kan man inte längre vara säker
på att man har hittat den optimala lösningen. De två mest använda datorprogrammen för multipel jämkning är Clustal, som är baserad på distans-metoder
och MALIGN, som är parsimonibaserad. Clustal har fördelen att det är snabbt,
men är dåligt på att hitta bra lösningar. MALIGN kräver mycket datorkraft,
och är nästan oanvändbart med en enkel persondator.
Ett nytt sätt att homologisera DNA, utan att göra en multipel jämkning, är
direktoptimering (DO). Här används en metod som liknar MALIGN, men som
betraktar jämkningen av DNA som optimering av karaktärer i ett parsimoniträd. I likhet med en heuristisk sökning efter de kortaste träden i en parsimonianalys jämför DO fylogenetiska träd, och den mängd insertioner, deletioner
och substitutioner som krävs för att förklara variationen mellan sekvenserna.
Det träd som kräver minst förändring är det mest parsimoniska, och mängden
förändringar är direkt jämförbar med trädlängden i standardparsimoni.
Ytterligare en metod för multipel jämkning av rDNA-sekvenser är sekundärstrukturjämkning. Även om sekvenser varierar mellan arter, så är mönstret
av stabila komplementära och variabla regioner likartat. European Ribosomal
Database tillhandahåller färdigjämkade rDNA-sekvenser från alla typer av organismer fritt tillgängliga på internet. Dessa är jämkade med referens till sekundärstrukturen, och forskare kan använda dem som mall för jämkning av
nyframtagna sekvenser.
Nackdelen med sekundärstrukturjämkning är densamma som för helt manuell jämkning, att det inte finns något optimalitetsbegrepp. Det finns inget sätt
att säga om en multipel jämkning är en bättre lösning än en annan. Det har
sagts att metoderna för multipel jämkning av sekvenser befinner sig i samma
position som kladisisk analys gjorde för 20 år sedan. Man skall inte glömma
att detta är ett lika viktigt steg som den fylogenetisk analysen i och med att
homologibedömningarna är helt beroende av hur jämkningen gjordes.
46
7.8
Presentation av artiklarna
I: Hovmöller,, R., Källersjö, M. and Pape, T., 2004. The Palaeoptera
problem: basal pterygote phylogeny inferred from 18S and 28S rDNA
sequences. Cladistics 18, 313–323.
Artikeln började som mitt examensarbete “Basal pterygote phylogeny - a molecular study” från Stockholms Universitet, 1999. För denna studie sekvenserade
vi 18S och 28S rDNA från 18 trollsländor, 8 dagsländor och den vinglösa klippsmygen Petrobius brevistylus. Resultatet blev ett starkt statistiskt stöd för ett
monofyletiskt Palaeoptera. Året efter kom en replik där vår artikel kritiserades
för att ha använd en olämplig jämkningsmetod (Clustal), och att vi inte tagit
med de morfologiska karaktärer som publicerats tidigare. De analyserade om
våra data med direktoptimeringsmetoder, såväl som Clustal, och drog slutsatsen att ett monofyletiskt Palaeoptera endast hittas inom ett “snävt område” av
jämkningsparametrar.
Ett “snävt område” är förstås en ren definitionsfråga. Ett intressant resultat
är att i de allra flesta analyser baserade på 18S finner stöd för ett monofyletiskt
Paleoptera, om gap (-) inte räknas med. Opistopera eller Metapterygota hittas
nästan aldrig på detta sätt, hur parametrarna än sätts. Räknas gap med, så blir
resultatet ett oupplöst träd. Men så fort de morfologiska karaktärerna läggs in,
så blir resultatet alltid ett monofyletiskt Metapterygota!
Det är tydligt att det finns en konflikt i informationen mellan 18S och de
morfologiska karaktärerna. Resultaten från 18S kan fortfarande räknas som tveksamma, och kontroversen kring Palaeoptera är långt ifrån avslutad.
II: Hovmöller, R and Johansson, F., 2004. A phylogenetic perspective on larval spine evolution in Leucorrhinia (Odonata: Libellulidae)
based on ITS1, 5.8S and ITS2 rDNA sequences. Molecular Phylogenetics and Evolution 30, 653–662.
Det här arbetet utfördes i samarbete med ekologen Frank Johansson vid Umeå
Universitet. Hans forskargrupp studerar ekologin hos trollsländelarver, och hur
de påverkas av fiskpredation. Leucorrhinia är ett litet släkte (14–16 arter beroende på hur man räknar) inom segeltrollsländorna. Släktet har fått sitt vetenskapliga namn från den frons, en plåt ovanför mundelarna, som lyser vitt i
ett övrigt mörkt ansikte. På klassisk grekiska betyder “leukos” vit och “rhis”
nos. På svenska kallas de kärrtrollsländor, eftersom flera av arterna föredrar
surt vatten i vitmossekärr. Släktet har en utbredning över norra halvklotets
nordligare delar, från Europa, över Ryssland, Kina och Japan, till USA och Kanada. Många trollsländelarver är beväpnade med taggar på bakkroppens rygg
och sidor. Hos kärrtrollsländorna varierar taggigheten mellan arterna. Så har till
exempel den breda kärrtrollsländan L. caudalis mycket taggiga larver, medan
den nordiska kärrtrollsländan L. rubicunda nästan helt saknar taggar. Frank
Johansson m.fl. har visat att taggarna är effektiva som ett skydd mot rovfisk,
och att förekomsten av arter är beroende av om det finns fisk i vattnet eller inte.
Ett syfte med den här undersökningen var att hitta en stabil fylogeni över
kärrtrollsländorna, så att det går att avgöra för varje art om avsaknaden av
taggar är en anpassning eller ett nedärvt tillstånd. Vi lyckades visa att taggarna
har förlorats åtminstone två gånger: dels hos den europiska arten L. rubicunda,
och i en grupp med nordamerikanska arter.
Fylogenin baserades på sekvenser från de mycket variabla spacer-regionerna (ITS) i de ribosomala paketen. Vi gjorde en egen version av parameterkänslighetsanalys, där Clustal kördes under många olika parameterinställningar och resultatet sammanställdes grafiskt. Vi upptäckte också att den mekanism som skall hålla kopior av ribosomala sekvenser identiska i genomet inte
hade lika stor inverkan över ITS som över 18S och 28S.
47
III: Hovmöller,, R. Monophyly of Ischnurinae (Odonata: Zygoptera,
Coenagrionidae) established from COII and 16S sequences. Opublicerat manuskript.
Det här är de första resultaten från ett pågående projekt om fylogeni inom
flicksländefamiljen Coenagrionidae. Indelningen i underfamiljer är baserad på
svårtolkade kvantitativa karaktärer, mest i vingribbmönstret. I mycket preliminära analyser över hela familjen Coenagrionidae fick jag endast fram denna
underfamilj som monofyletisk, och jag bestämde mig för att koncentrera mig
på den. Det är också den enda underfamiljen som är definierad på otveksamma
karaktärer, som att honorna har en tagg i anslutning till äggläggaren och att
hanarna har ett upphöjt utskott på bakkroppssegment 10.
Två mitokondriella gener användes: den proteinkodande COII och den ribosomala 16S. Här använde jag en annan strategi för jämkningen av de ribosomala
sekvenserna, en kombination av Clustal och parsimonijämkning med ett direktoptimiseringsprogram. Resultatet blev betydligt bättre träd än de jag skulle
funnit om jag helt förlitat mig på Clustal för jämkningen.
Ischnurinae domineras av två stora släkten med ca 70 arter vardera: Enallagma, representerat av arten E. cyathigerum i Sverige, och Ischnura med med
två svenska arter I. elegans och I. pumilio. Utöver dessa finns en mängd mindre släkten, varav de flesta bara innehåller en eller ett fåtal arter. Jag fann att
Ischnura är monofyletiskt, men Enallagma var som tidigare förslagits en ickenaturlig grupp. Historisk sett har Enallagma använts för den holarktiska grupp
dit E. cyathigerum hör, men också för vissa afrikanska arter. Den holarktiska
gruppen är monofyletisk, men de afrikanska arterna bör placeras i egna släkten.
IV: Hovmöller, R. A catalog of species group names in the genus Coenagrion Kirby, 1890 (Odonata: Coenagrionidae). Opublicerat manuskript.
En katalog är ett rent taxonomiskt arbete och innehåller inte någon analytisk
del. Ändå är kataloger helt nödvändiga för de som forskar inom systematik.
Det finns ingen samlande databas för information om artbeskrivningar, typmaterial eller vilka namn som är giltiga. All den informationen finns spridd i
originallitteraturen och i bibliografisk litteratur som Zoological Record. Kataloger sammanställer den spridda informationen för en mindre grupp, och gör i
bästa fall arbetet lite lättare för den som skall arbeta med gruppen systematiskt.
Ett oväntat resultat av denna sammanställning var att arten Coenagrion exornatum, som finns upptagen i flera artlistor, helt enkelt aldrig har funnits! Det
namnet är från början en felskrivning i W. F. Kirbys katalog över trollsländor
från 1890. Senare sammanställare har tagit med alla arter som Kirby tog upp,
och felet har kvarstått.
V: Hovmöller, R. A proposal to conserve the name Calopteryx Leach,
1815 over Agrion Fabricius, 1775. Opublicerat manuskript.
Det här är en gammal fråga som aldrig har fått en slutgiltig lösning: vilket är
det giltiga vetenskapliga namnet på jungfrusländorna i släktet Calopteryx ?
Återigen figurerar W. F. Kirby. Inom taxonomi är namnprioritet en av
grundstenarna. Det första namn som publicerats för en art, släkte eller familj
är också det som skall användas. För att skydda väletablerade namn som hotas av ett bortglömt, men äldre namn, finns det en nomenklaturkommission
som beslutar om ett väletablerat namn skall vara giltigt trots att det inte har
prioritet.
Jungfrusländorna placerades tillsammans med alla andra Zygoptera i släktet
Agrion av Fabricius (1775). Leach (1815) upprättade släktet Calepteryx (senare
omstavat till Calopteryx ) för “Agrionider med färgade vingar”, och detta namn
slog igenom hos de tongivande odonatologerna under 1800-talet. Agrion fortsatte att användas för andra grupper inom flicksländorna. Kirby var en stark
anhängare av namnprioritet, något som ännu inte var helt accepterat år 1890.
48
Han upptäckte att Latreille redan 1802 hade utsett Agrion virgo som typart för
släktet, och införde ett nytt namnskick inom Zygoptera. De som kallats Calopteryx hette nu Agrion, och de som hetat Agrion placerades i det nyupprättade
släktet Coenagrion.
Namnet Agrion användes för båda grupperna, och resultatet blev en del
förvirring och en hätsk debatt. Erich Schmidt (1948), ifrågasatte lämpligheten i
att över huvud taget använda Agrion. “Om jag skriver Calopteryx [. . . ] förstår
alla omedelbart vad jag syftar på”, menade han. Ett skarpt svar kom året därpå
och en hetsig debatt utbröt i tidskriften Entomological News. 1954 hade debatten lugnat ner sig, och Montgomery publicerade en mycket noggrann genomgång
av nomenklaturfrågan. Han fann att formellt sett så har Agrion prioritet över
Calopteryx. Detta har inte följts av senare års odonatologer, och Agrion har
knappast använts alls de senaste 20 åren. Trots det är Calopteryx formellt sett
ett ogiltigt namn, något som ofta påpekas i faunistisk litteratur. Detta manuskript är en formell ansökan till kommissionen för zoologisk nomenklatur om att
ge Calopteryx status som giltigt namn, och placera Agrion på listan över namn
som inte kan användas. Jag har cirkulerat manuskriptet bland odonatologer i
flera världsdelar för att undvika att trampa i ett getingbo som Erich Schmidt!
49
50
Chapter 8
Acknowledgments
I owe my thesis advisors Thomas Pape, Mari Källersjö and Kjell Arne Johanson
thanks for their patience and support. Thomas, thank you for your indefatigable encouragement and insights on insects. Mari, I have never received a single
piece of bad advice from you, and because of you, my writing has really become
more better. Kjell Arne, thank you for always taking time, for advice, reading
and commenting on my texts and for dealing with all the bureaucracy.
The faunistics team: Erland Dannelid, Magne Friberg, Johan Lind, Johan Liljeblad, Fredrik Stjernholm, Helena Strömberg and Lisa Weingartner. We have
had fun, accidents and even fun accidents teaching field courses on Öland and
elsewhere 2001-2005.
I wish to thank everyone at the Molecular Systematics Laboratory. Residents
and transients: Pia Eldenäs and Bodil Cronholm for technical assistance and
good advice. Former and current PhD students – I have learned a lot from
our discussions. Invertebrate enthusiasts: Ida Envall, Micke Norén, and Erica
Sjölin. Fans of fins, feathers and fangs: Rei Dehghani, Bo Delling, Martin Irestedt, Jan Ohlson and Ulf Johansson. Experts on things green: Petra Korall,
Catarina Rydin, Jenny Smedmark, Ida Trift and Livia Wanntorp.
Odonatologists around the world: thank you for sharing your knowledge and
material. In approximately west-eastern order: Frank Johansson and Göran
Sahlén in Sweden, Matti Hämäläinen in Finland, KD Dijkstra in the Netherlands, Henri Dumont in Belgium, Viola Clausnitzer in Germany, Oleg Kosterin in Russia, Tohru Yokoyama in Japan, Kim Pullen in Australia, Frederico
Lencioni in Brazil, Dennis Paulson, Rosser Garrison, Seth Bybee and Heath Ogden in the USA and Jeff Skevington, Reg Webster and Paul Brunelle in Canada.
Thanks for fantastic phylogenetic software: James Farris, Pablo Goloboff, Fredrik
Ronquist and Ward Wheeler.
For science and cinnamon rolls: Jonathan Habib-Enqvist, Cinna Lindqvist, Gunilla Röör and Sofie Sweger. Artists know when they are creating art.
51
Everyone at the department of entomology: My office mates – James Bonet,
dipterologist, hi-fi enthusiast and coffee-connaisseur. Tobias Malm, trichopterologist, disco bandit and TNT-hacker. Ellen Rehnberg, prospective arachnologist,
mantis feeder and socialite. Office neighbors – Marianne Espeland, the new kid.
Mattias Forshage, Canadian field trip companion and a true polyhistor. Niklas
Jönsson, beetle fan and pet farmer. Andrea Klintbjer, unrivaled illustrator.
Bert Gustafsson, Kevin Holston, Torbjörn Kronestedt, Gunnel Sellerholm and
Bert Viklund who actually know the collections – I still get lost. Marie Svensson, not afraid to stare bureaucracy in the face.
Bertil Borg is thanked for comments that really improved the text in this thesis.
Sören Nylin and Hans-Erik Wanntorp: thank you for the undergraduate class
on evolutionary biology back in 1997. That’s when this thesis started.
52
Bibliography
Alexander, R. D., Brown, W. L., 1963. Mating behaviour and the origin of insect
wings. Occasional papers of the Museum of Zoology, University of Michigan
628, 1–19.
Askew, R. R., 1988. The Dragonflies of Europe. Harley Books, Colchester, UK.
Bechly, G., Brauckmann, C., Zessin, W., Gröning, E., 2001. New results concerning the morphology of the most ancient dragonflies (Insecta:
Odonatoptera) from the Namurian of Hagen-Vorhalle (Germany). Journal of
Zoological Systematic & Evolutionary Research 39, 209–226.
Benard, M. F., 2004. Predator-induced phenotypic plasticity in organisms with
complex life histories. Annual Review of Ecology, Evolution and Systematics
35, 651–673.
Boudreaux, H. B., 1979. Arthropod phylogeny with special reference to insects.
Wiley, New York, USA.
Carpenter, F. M., 1966. The lower Permian insects of Kansas. Part II. The
orders Protorthoptera and Orthoptera. Psyche 73, 46–88.
Carpenter, F. M., Burnham, L., 1985. The geological record of insects. Annual
Review of Earth and Planetary Sciences 13, 297–314.
Davies, D., Tobin, P., 1984. The dragonflies of the world: A systematic list
of the extant species of Odonata. Vol.1 Zygoptera, Anisozygoptera. No. 3 in
Rapid Communications (Supplements). Societas Internationalis Odonatologica, Utrecht, Germany.
de Sélys-Longchamps, E., 1850. Revue des Odonates ou Libellules d’Europe.
Muquart, Brussels, Belgium.
de Sélys-Longchamps, E., 1872. Matériaux pour une faune névroptérologique.
Annales de la Société Entomologique de Belgique 15.
de Sélys-Longchamps, E., 1876. Synopsis des Agrionines. Bulletin de l’Académie
Royale des Sciences de Belgique 41.
Douglas, M. M., 1981. Thermoregulatory significance of thoracic lobes in the
evolution of insect wings. Science 211, 84–86.
Eberhard, W. G., 1985. Sexual Selection and Animal Genitalia. Harvard University Press, Cambridge, MA, USA.
Eddy, S., 2003. HMMer 2.3.2:
http://hmmer.wustl.edu.
Software and manual. Available from
Engel, M. S., Grimaldi, D. A., 2004. New light shed on the oldest insect. Nature
427, 627–630.
Fabricius, J. C., 1775. Systema Entomologiae, sistens insectorum classes, ordines
genera, species, adiectus synonymus, locis, descriptionibus, observationibus.
Korte, Flensburgi et Lipsiae [Flensburg and Leipzig, Germany].
53
Farris, J. S., 1970. A method for computing Wagner trees. Systemaic Zoology
19, 83–92.
Fincke, O. M., 1997. Conflict resolution in the Odonata: implications for understanding female mating patterns and female choice. Biological Journal of
the Linnaean Society 60, 201–220.
Fitch, W. M., 1971. Toward defining the course of evolution: minimum change
for a specific tree topology. Systematic Zoology 20, 406–416.
Foote, B. A., 1991. Hippoboscidae. In: Stehr, F. W. (Ed.), Immature insects.
Vol. 2. Kendall / Hunt, Ch. 37, pp. 878–879.
Fraser, F., 1957. A Reclassification of the order Odonata. Royal Zoological Society of New South Wales.
Gilbert, W., 1986. Origin of life: The RNA world. Nature 319, 618.
Giribet, G., 2005. Generating implied alignments under direct optimization using POY. Cladistics 21, 396–402.
Giribet, G., Rivera, C., 2000. A review of arthropod phylogeny: new data based
on ribosomal DNA sequences and direct character optimization. Cladistics 16,
204–231.
Gladstein, D. L., Wheeler, W. C., 2003. POY. Program and documentation.
American Museum of Natural History. Current version 3.0.11 (2003) available
from ftp://ftp.amnh.org/people/wheeler/poy.
Goloboff, P., Nixon, K., Farris, J. S., 2005. TNT 1.0 Software and manual.,
published by the Authors.
Grant, T., Kluge, A. G., 2003. Data exploration in phylogenetic inference: scientific, heuristic, or neither. Cladistics 19, 379–418.
Grimaldi, D., Engel, M. S., 2005. Evolution of the Insects. Cambridge University
Press, New York, USA.
Haeckel, E., 1866. Generelle Morphologie der Organismen. Gerog Reimer,
Berlin, Germany.
Handlirsch, 1937. Neue Untersuchungen über die fossilen Insekten I. Annalen
den Naturhistorischen Museums in Wien 48, 1–140.
Hasegawa, E., Kasuya, E., 2006. Phylogenetic analysis of the insect order
Odonata using 28S and 16S rDNA sequences: a comparison between data
sets with different evolutionary rates. Entomological Science 9, 55–66.
Hennig, W., 1966. Phylogenetic systematics. University of Illinois Press.
Hennig, W., 1981. Insect Phylogeny. John Wiley & Sons, Bath, UK.
Higgins, D. G., Sharp, P. M., 1988. CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 73, 237–244.
Johansson, F., 2002. Reaction norms and production costs of predator-induced
morphological defences in a larval dragonfly (Leucorrhinia dubia: Odonata).
Canadian Journal of Zoology 80, 944–950.
Johansson, F., Samuelsson, L., 1994. Fish-induced variation in abdominal spine
length of Leucorrhinia dubia (Odonata) larvae? Oecologia 100, 74–79.
Kingsolver, J. G., Koehl, M. A. R., 1985. Aerodynamics, thermoregulation, and
the evolution of insect wings: differential scaling and evolutionary change.
Evolution 39, 488–504.
54
Kingsolver, J. G., Koehl, M. A. R., 1994. Selective factors in the evolution of
insect wings. Annual Review of Entomology 39, 425–51.
Kirby, W. F., 1890. A synonymic catalogue of Neuroptera Odonata, or dragonflies. Gurney & Jackson, London, UK.
Kjer, K. M., 2004. Aligned 18S and insect phylogeny. Systematic Biology 53,
506–514.
Kluge, A. G., 1998. Total evidence or taxonomic congruence: cladistics or consensus classification. Cladistics 14, 151–158.
Krieger, F., Krieger-Loibl, E., 1958. Bieträge zum Verhalten von Ischnura elegans und Ischnura pumilio (Odonata). Zeitschrift für Tierpsychologie 15,
83–93.
Kristensen, N. P., 1975. The phylogeny of hexapod “orders”. A critical review
of recent accounts. Zeitschrift für zoologische Systematik und Evolutionsforschung 13, 1–44.
Kristensen, N. P., 1981. Phylogeny of insect orders. Annual Review of Entomology 26, 135–57.
Kristensen, N. P., 1991. The phylogeny of extant hexapods. In: Naumann, I. D.,
Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry, J. P., Taylor, R. W.,
Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of Australia: A textbook
for students and research workers, 2nd Edition. Vol. 1. CSIRO, Melbourne
University Press, Melbourne, Australia, Ch. 5, pp. 125–140.
Kukalová-Peck, J., 1978. Origin and evolution of insect wings and their relation
to metamorphosis, as documented by the fossil record. Journal of Morphology
156, 53–126.
Kukalová-Peck, J., 1983. Origin of the insect wing and wing articulation from
the arthropodan leg. Canadian Journal of Zoology 61, 1618–1669.
Kukalová-Peck, J., 1987. New Carboniferous Diplura, Monura and Thysanura,
the hexapod ground plan, and the role of thoracic side lobes in the origin of
wings (Insecta). Canadian Journal of Zoology 65, 2327–2345.
Kukalová-Peck, J., 1991. Fossil history and the evolution of hexapod structures.
In: Naumann, I. D., Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry,
J. P., Taylor, R. W., Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of
Australia: A textbook for students and research workers, 2nd Edition. Vol. 1.
CSIRO, Melbourne University Press, Melbourne, Australia, Ch. 6, pp. 141–
179.
Latreille, P. A., 1810. Considérations générales sur l’ordre naturel des animaux
composant les classes des Crustacés, des Arachnides et des Insects avec un
tableu méthodique de leurs genres disposés en familles. Schoell, Paris, France.
Latreille, P. L., 1807. Genera Crustaceorum et Insectorum secundum ordinem
naturalem in familias doisposita, iconibus exemplurisque plurimis explicata.
Amand Koenig, Paris.
Leach, W. E., 1815. Edinburgh Encyclopediae. Vol. 9. Brewster, Edinburgh,
UK, Ch. Entomology, pp. 57–172.
Lemche, H., 1940. The origin of winged insects. Videnskablige Meddelelser fra
Dansk Naturhistorisk Forening i København 104, 127–168.
Linnaeus, C., 1758. Systema Naturae, 10th Edition. Vol. 1. Laurentii Salvii,
Holmiae [=Stockholm], Sweden.
Lipscomb, D. L., Farris, J. S., Källersjö, N., Tehler, A., 1998. Support, ribosomal
sequences and the phylogeny of eukaryotes. Cladistics 14, 303–338.
55
Lohmann, H., 1996. Das phylogenetische System der Anisoptera (Odonata).
Entomologische Zeitschrift 106, 209–252.
Loibl, E., 1958. Zur Ethologie und Biologie der deutschen Lestiden (Odonata).
Zeitschrift für Tierpsychologie 15, 54–82.
Longfellow, C., 1949. Agrion versus Calopteryx. Entomological News 60, 145–
146.
Marden, J. H., Kramer, M. G., 1994. Surface-skimming stoneflies: A possible
intermediate stage in insect flight evolution. Science 266, 427–430.
Martynov, A. V., 1925. Über zwei Grundtypen der Flügel bei den Insekten und
ihre Evolution. Zeitchrift für Morphologie und Ökologie der Tiere 4, 465–501.
May, M. L., 2002. Phylogeny and taxonomy of the damselfly genus Enallagma
and related taxa (Odonata: Zygoptera: Coenagrionidae). Systematic Entomology 27, 387–408.
Mickevich, M. F., Farris, J. S., 1981. The implications of congruence in Menidia.
Systematic Zoology 30, 351–370.
Mizutani, A., Chahl, J. S., Srinivasan, M. V., 2003. Motion camouflage in dragonflies. Nature 423, 604.
Montgomery, B. E., 1954. Nomenclatural confusion in the Odonata: The AgrionCalopteryx problems. Annals of the Entomological Society of America 47,
471–483.
Munz, P. A., 1919. A venational study of the suborder Zygoptera. Memoirs of
the American Entomological Society 3, 1–78.
Needham, J. G., 1903. A genealogic study of dragon-fly wing venation. Proceedings of the United States Natural Museum 26, 703–764.
Needleman, S. B., Wunsch, C. D., 1970. A general method applicable to the
search for similarities in the amino acid sequence of two proteins. Journal of
Molecular Biology 48, 443–453.
Norén, M., Jondelius, U., 1999. Phylogeny of the Prolecithophora (Platyhelminthes) inferred from 18S rDNA Sequences. Cladistics 15, 103–112.
Ogden, T., Whiting, M. F., 2003. The problem with ”the Paleoptera problem:”
sense and sensitivity. Cladistics 19, 432–442.
O’Grady, E. W., May, M. L., December 2003. A phylogenetic reassessment of
the subfamilies of Coenagrionidae (Odonata, Zygoptera). Journal of Natural
History 37, 2807–2834.
Ólafsson, E., 1975. Drekaflugan Hemianax ephippiger (Burm.) (Odonata)
óvæntur gestur á ı́slandi. Náttúrufrækingurinn 45, 209–212, [In Icelandic].
Pajunen, V. I., 1964. Mechanism of sex recognition in Leucorrhinia dubia v.
d. Lind., with notes on the reproductive isolation between L. dubia and L.
rubicunda L. (Odon., Libellulidae). Annales Zoologici Fennici 1, 55–71.
Paulson, D., Schorr, M., Lindeboom, M., 2006. World Odonata List. Webiste.
http://www.ups.edu/x6140.xml.
Paulson, D. R., 1974. Reproductive isolation in damselflies. Systematic Zoology
23, 40–49.
Peters, W. L., Campbell, I. C., 1991. Ephemeroptera. In: Naumann, I. D.,
Carne, P. B., Lawrence, J. F., Nielsen, E. S., Spradberry, J. P., Taylor, R. W.,
Whitten, M. J., Littlejohn, M. J. (Eds.), Insects of Autralia, 2nd Edition.
Vol. 1. CSIRO, Melbourne University Press, Melbourne, Australia, Ch. 16,
pp. 279–293.
56
Phillips, A., Janies, D., Wheeler, W., 2000. Multiple sequence alignment in
phylogenetic analysis. Molecular Phylogenetics and Evolution 16, 317–330.
Rambur, M. P., 1842. Histoire Naturelles des insectes Néuroptères. Librairie
encyclopédique de Roret, Paris, France.
Rehn, A. C., 2003. Phylogenetic analysis of higher-level relationships of
Odonata. Systematic Entomology 28, 181–239.
Robertson, H. M., Paterson, H. E. H., 1982. Mate recognition and mechanical
isolation in Enallagma damselflies (Odonata: Coenagrionidae). Evolution 36,
243–250.
Ronquist, F., Huelsenbeck, J. P., 2003. MRBAYES 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19, 572–1574.
Rousset, V., Rouse, G. W., Siddall, M. E., Tillier, A., Pleijel, F., 2004. The
phylogenetic position of Siboglinidae (Annelida) inferred from 18S rRNA,
28S rRNA and morphological data. Cladistics 20, 518–533.
Saitou, N., Nei, M., 1987. The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 6, 514–
525.
Saux, C., Simon, C., Spicer, G. S., 2003. Phylogeny of the dragonfly and damselfly order Odonata as Inferred by mitochondrial 12S ribosomal RNA Sequences. Annals of the Entomological Society of America 96, 693–699.
Schmidt, E., 1948. Calopteryx versus Agrion: Again? (Odonata). Entomological
News 59, 197–201.
Silsby, J., 2001. Dragonflies of the World. Smithsonian Institution Press, Washington, D.C., USA.
Sneath, P., Sokal, R. R., 1973. Numerical Taxonomy: The principles and practiceof numerical classification. Freeman, San Fransisco, CA, USA.
Snodgrass, R. E., 1935. Principles of insect morphology. McGraw-Hill Book
Company, New York, USA.
Soltis, D. E., Soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Zanis, M., Savolainen, V., Hahn, W. H., Hoot, S. B., Fay, M. F., Axtell, M.,
Swensen, S. M., Prince, L. M., Kress, J. W., Nixon, K. C., Farris, J. S., 2000.
Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences.
Botanical Journal of the Linnaean Society 133, 381–461.
Tehler, A., Farris, J. S., Lipscomb, D. L., Källersjö, M., 2000. Phylogenetic
analyses of the fungi based on large rDNA data sets. Mycologia 92, 459–474.
Tennessen, K. J., 1997. The rate of species descriptions in Odonata. Entomological News 108, 122–126.
Thompson, J., Higgins, D., Gibson, T., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic acids
research 22, 4673–4680.
Thompson, J. D., Higgins, D. G., Gibson, T. J., 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment through sequence
weighting, positions specific gap penalties and weight matrix choice. Nucleic
Acids Research 25, 4876–4882.
Trueman, J. W. H., 1996. A preliminary cladistic analysis of odonate wing
venation. Odonatologica 25, 59–72.
57
Trueman, J. W. H., 1999. The enigmatic Australian endemic species
Hemiphlebia mirabilis Selys (Zygoptera: Hemiphlebioidea): four short observations and a new record. International Journal of Odonatology 2, 115–121.
Tsuda, S., 2000. A Distributional List of World Odonata. Published by author,
Osaka, Japan.
Van de Peer, Y., Jansen, J., De Rijk, P., De Wachter, R., 1997. Database on
the structure of small ribosomal subunit RNA. Nucleic Acids Research 25,
111–116.
Waage, J. K., 1975. Reproductive isolation and the potential for character displacement in the damselflies, Calopteryx maculata and C. aequabilis
(Odonata: Calopterygidae). Systematic Zoology 24, 24–36.
Wallberg, A., Thollesson, M., Farris, J. S., Jondelius, U., 2004. The phylogenetic
position of the comb jellies (Ctenophora) and the importance of taxonomic
sampling. Cladistics 20, 558–578.
Warren, A., 1915. Dragonflies and their food. Proceedings of the Hawaiian Entomological Society 3, 72–82.
Westfall, Jr., M. J., May, M. L., 1996. Damseflies of North America. Scientific
Publishers, Gainsville, USA.
Wheeler, W., 1995. Sequence alignment, parameter sensitivity, and the phylogenetic analysis of molecular data. Systematic Biology 44, 321–331.
Wheeler, W., 1996. Optimization alignment: The end of multiple sequence alignment in phylogenetics? Cladistics 12, 1–9.
Wheeler, W., 1999. Fixed character states and the optimization of molecular
sequence data. Cladistics 15, 379–385.
Wheeler, W. C., 2003a. Implied alignment: a synapomorphy-based multiplesequence alignment method and its use in cladogram search. Cladistics 19,
261–268.
Wheeler, W. C., 2003b. Iterative pass optimization of sequence data. Cladistics
19, 254–260.
Wheeler, W. C., 2006. Dynamic homology and the likelihood criterion. Cladistics
22, 157–170.
Wheeler, W. C., Gladstein, D. L., 1994. MALIGN. Program and documentation.
American Museum of Natural History, current version 2.7 (2002) available
from ftp://ftp.amnh.org/people/wheeler/.
Wheeler, W. C., Whiting, M., Wheeler, Q. D., Carpenter, J. M., 2001. The
phylogeny of the extant hexapod orders. Cladistics 17, 113–169.
Whiting, M. F., Carpenter, J. C., Wheeler, Q. D., Wheeler, W. C., 1997. The
strepsiptera problem: phylogeny of the holometabolous insect orders inferred
from 18S and 28S ribsosomal DNA sequences and morphology. Systematic
Biology 46, 1–68.
Wigglesworth, V. B., 1963a. Origin of wings flight in insects. Proceedings of the
Royal Entomological Society of London 28, 23–32.
Wigglesworth, V. B., 1963b. Origin of wings in insects. Nature 197, 97–98.
Will, K. W., 1995. Plecopteran surface-skimming and insect flight evolution.
Science 270, 1684.
Wuyts, J., Perrière, G., Van de Peer, Y., 1994. The European ribosomal
database. Nucleic Acids Research 32, 101–103.
58
Zherikhin, V. V., 2002. Pattern of insect burial and conservation. In: History of
Insects. Kluwer Academic Publishers, Dordrecht, Netherlands, Ch. 1.4, pp.
17–62.
Zimmer, E. A., Martin, S. L., Beverly, S. M., Kan, Y. W., Wilson, A. C.,
1980. Rapid dupliactions and loss of genes coding for chains of hemoglobin.
Proceedings of the National Academy of Sciences, USA 77, 2158–2162.
Zwick, P., 1980. Handbuch der Zoologie : eine Naturgeschichte der Stämme des
Tierreiches. Vol. 4. Walter de Gruyter, Berlin, Germany.
59