...

O A

by user

on
Category: Documents
7

views

Report

Comments

Description

Transcript

O A
1651
Journal of Applied Sciences Research, 9(3): 1651-1665, 2013
ISSN 1819-544X
This is a refereed journal and all articles are professionally screened and reviewed
ORIGINAL ARTICLES
Assessment of Genetic Diversity and Relationships among canola (Rapeseed) Varieties
Using Random Amplified Polymorphic DNA (RAPD) and Specific-PCR Analysis
1
El-Mouhamady, A.A., 1A.A. Abdel-Sattar and 2E.H.El-seidy
1
Genetics and cytology Department, Genetic Engineering and Biotechnology Division, National Research
Center, Dokki, Cairo, Egypt.
2
Dept. of Agronomy, Faculty of Agriculture, Tanta University
ABSTRACT
This study was done in the genetics and cytology Department, Genetic Engineering and Biotechnology
Division, National Research Center, Egypt from 25 November 2009 to 25 April 2011 using six cultivars of
canola, namely, Brassica napus (Denmark), Brassica napus (serw 4), Brassica napus (impulse), Brassica napus
(sakha 1), Brassica napus (pactol) and Brassica compestsis (torch), respectively; to study the genetic behavior
through some genetic parameters such as "heterosis over better parent, General and specific combining ability
effects and correlation coeffient by using line x tester analysis with three replicated in a randomized complete
black design and some techniques of biotechnology; such as, three Random Amplified polymorphic DNA
(RAPD) namely AAU-B9, AAU-B10 and AAU-B11 primers. In addition to three specific-RCR-Primers for
some unsaturated fatty acids "oleic, linoleic and linolenic fatty acid), namely GT-1, GT-2 and GT-3
respectively.
The results indicated that:
1):- Significant and highly significant positively of heterosis over better parent and specific combining ability
effects were observed from the crosses;
B. napus (Denmark) x B. napus (impulse),
B. napus (Denmark) x B. compestsis (torch),
B. napus (serw 4) x B. napus (sakha 1) and
B. napus (serw 4) x B. compestsis (torch), while, the most desirable mean values and highly significant of
positive general combining ability effects were showed from the parents; B. napus (serw 4) and B. compestis
(torch), respectively.
2):- Highly differences were detected between cultivars of canola by using the analysis of protein and RAPDPCR (AAU-B9, AAU-B10 and AAU-B11) primers respectively.
3):- The bands number six and three with molecular weights of 600 and 1250 bp were specific-markers for oleic
and linoleic fatty acids, while the bands number two, seven and eight with molecular weight of 1350, 650 and
350 bp were also specific bands for linolenic fatty acid in the parents; (P5, P6), (P1, P2, P3) and (P4), by using
GT-1, GT-2 and GT-3 (specific-primers), respectively.
Key words: Canola (rapeseed) – RAPD-Specific-RCR marker cluster analysis.
Introduction
Canola varieties grown in Canada belong to the Brassica napus, B. rapa or B. Juncea species, which in trun
belong to the much larger mustard family since B. napus and B. rape species were first introduced in Canada,
plant breeders have developed many varieties. The development of these varieties with major improvement in
agronomic, oil and meal Quality greatly influenced the rapid expansion of the canola industry in Canada,
especially during the last decade. Improved seed Quality increased the market for canola seed and its products.
In 2002, B. Juncea was introduced under contract production. There are considerable differences in agronomic
characteristics and yield between species and between varieties.
Evaluate these differences carefully when selecting avariety to grow. Choose the variety that is best suited
to local conditions.
Until the early 1990's, Brassica rapa was referred to as Brassica compestris. The difference in species name
arose from an error in classification made by the 18th century father of taxonomy, carolus linnaeus. He named
the turnip producing Brassica species B. rapa – rapa being Latin for root.
The mustard family consists of about 3,000 species of plants found mainly in the northern hemisphere.
Corresponding Author: El-Mouhamady, A.A., Dept of Genetics and Cytology, Division of Genetic Engineering and
Biotechnology, National Research Center-Dokki-Cairo Egypt,
E-mail: [email protected]
1652
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
The name crucifer originates from the arrangement of the plants flower petals- Diagonally opposite each
other in the form of across. Many Brassica species have been cultivated since prehistoric times for their edible
roots, stems, leaves, buds, flower and seeds.
The relationships are important to canola plant breeders since they provide wide sources of genetic features
for research purposes and the biggest aim to increase Quality and yield traits by using the new method of
biotechnology and trans for this strategy to Egyptian varieties using RAPD- specific PCR analysis and
techniques of isozymes.
Materials and Method
This experiment was done from 2009 to 2011 seasons in Mansourah city using six cultivars of canola
namely:
1) Brassica napus (Denmark) Chine 1981.
2) Brassica napus (Serw 4)
3) Brassica napus (Impulse) France 1998.
4) Brassica napus (Sakha 1)
5) Brassica napus (Pactol) France.
6) Brassica compestsis (torch) France 1980
Respectively. the first and second cultivars were used as testers, while the other genotypes were used as
lines using line x tester design.
The parental genotypes were grown in three planting dates with ten days interval in order to overcome the
differences in flowering time between parents to make hybridization from 25 November 2009 to 10 January
2010.
All genotypes (parents and their crosses) were grown in a randomized complete Block design with three
replications from 25 November 2010 to 25 April (2011) and the package of all other recommendations of canola
planting was followed in 2011 season.
Table 1: The main characteristics of the six genotypes of canola used as parents in a line x tester analysis.
No
Pedigree
Origin
1
2
3
4
5
6
Brassica napus (chine 1981)
Brassica napus (serw 4)
Brassica napus (impulse)
Brassica napus (sakha 1)
Brassica napus (pactol)
Brassica compestsis (torch)
Denmark 1981
Egypt
France 1998
Egypt
France
France 1980
Duration per
(days)
147
150
143
148
145
152
Traits studied:
Thirty plants were taken from the parents and F1 crosses at random from each replicate to determine all
traits.
1- Plant height (cm): Length of main culm was measured from the soil surface to the tip of the main panicle at
maturity.
2- Weight of 1000 – seeds (gm): Was recorded as the weight of 1000 – random filled seeds per plant.
3- Seed yield (kg/fed): Was recorded as the weight of seed yield of individual plant and adjusted to 14%
moisture content.
4- Oil yield (kg/fed): Was recorded as the weight of oil yield for individual plant per (kg/fed).
5- Estimates some unsaturated fatty acids (oleic, linoleic and α- linolenic acid) were described by the method
of Sajbider et al. (1994).
A. Statistical analysis:
A.1. Analysis of variance:
The analysis of variance was determined by the method of (IRRI, 2005).
A.2. Estimates of heterosis over better – parent:
Was described by the method of Wyanne et al. (1970).
A.3. Estimates of combining ability effects:
1653
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
It was computed according to Wyanne et al. (1970) and Virmani et al (1997).
A.4. Correlation coefficients:
It determined by method of Fieller et al. (1957).
B. Molecular markers:
B.1. SDS-protein electrophoresis:
It was performed for water soluble leaf proteins in the parents of canola plants according to Laemmli (1970)
as modified by Studier (1973).
B.2. PCR-based DNA analysis:
DNA was extracted from the leaves of the six parents in canola wich different reaction for some traits such
as (plant height, weight of 1000 – seeds, seed yield, oleic, linolenic and linolenic acid).
Respectively, according to the method of Williams et al. (1990), Graham and Henry (1997) and Sharma et
al. (2003).
B.3. RAPD and Specific-PCR protocol:
Three primers of RAPD-PCR were used to identyfi the parents of canola namely; AAU-B9, AAU-B10 and
AAU-B11, in addition to design three specific-PCR primers as index for high level of oleic, linoleic and
linolenic acid, namely, GT-1, GT-2 and GT.3, respectively.
The first primer (GT-1):
1ACCTGAATTCCTTTCCCAAATCCTGGATCCTTCCTAGGTCCTG41ACCTCCTGGAACCGGATGC
61CCTAGGGTACCTGTACCATTT881CCAGGGTTTACCGACCTGGGTAAGGTACCACCAGGAGTTAA
121CCTGTAACCTAGGAAGGAATTTCCCGTGGTTTCCAATCCCT1181AAGTCCTAAACCCTGGGCCC
TAACCTGAACCTTTCCAGGTT331TCAAACACCGGGTTACCCTTGGGAAACCTACAGGGTAAATC
381ACTCGGGCTTCACATAACTAACCTCCTGGTAACCTACCTGG441GAAGGCCTATGTACCTGTC
The second primer (GT.2):
1GTCAACCATAAGGTCCTAGGGTAACACCTGGATCCTACAAAT131CCCTGGTAACCCTGTGAC
CTCAGGTACCTCCAATGGTCCTA171AGATAGCGCTCCTAAGGTACGGTCCTAACCTAACTGGGTCT
201CTAGAGCGCGTCTCTTCCCTGGGTCCTGAAACTCTAGGACC501TGGTTCCTCTAAGGACTACTG
GACCCTCAGATTTCAG
The third primer (GT-3):
1TTGGCAATCCGAATCCACGCCCTACCGGGGAAAAATCCTCCA61CTAAACTACCTGGGAATTT
CCTACTACTCGCGTAACTGAATC141CGGAATCCAACCTAGGACTCCTAAGGATCCTAGGGAATAC1
181CTAGGACCAAGGGAAATTTAAACCGGCCTAAACGGGTCCA281TGGGAAATTTGCCTCCAGGAC
TAAGGACACTAGGGACCTC3371AACCTGACTAGGACCTACCAGGGACTACGATTACCGATGGAAC
CATTA.
Table 2: The sequences of RAPD and specific-PCR analysis for the six parents of canola.
Names
Sequences
AAU-B9
5\- T C G C C AA CCG- 3\
AAU-B10
5\- A GG TTT CCCT -3\
AAU-B11
5\- GGG CG TGAGG - 3\
GT-1 for (Oleic acid level)
Forward:- 5\- ACCTGAATTCCTTTCCCAAT-3\
Reverse:- 5\- TGTCCATGTATCCGGAAGGG-3\
GT-2 for (linoleic acid level)
Forward:- 5\-CGTCAACCATAAGGTCCTAG-3\
Reverse:- 5\-GACTTTAGACTCCCAGGTCA-3\
GT-3for (linolenic acid level)
Forward:- 5-\TTGGCAATCCGAATCCACGC-3\
Reverse:- 5-\ATTACCAAGGTAGCCATTAG-3\
1654
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
B.3.1. Cluster analysis and dendograms were performed by the methods of Kaufman and Rousseuw (1990),
Legendre and Legendre (1998) and MCGune and Grace (2002).
Results and discussion
A. Analysis of variance:
Highly significant variations were estimated between genotypes, parents, crosses, lines, testers and the
interaction between lines and testers in all traits studied in table (3). Similar results were in agreement with those
reported by El-Said (2007).
B. Mean performance:
The Data presented in table (4). Cleared that, the lowest mean values towards dwarfism for plant height trait
were observed from the parents, P2, P4 and the crosses P1 x P3, P1 x P6, P2 x P4 and P2 x P6, while, the
parents; P2, P3, P6 in addition to the same crosses were produced the highest mean values for the other traits
studied and were the most desirable values in this study.Similar results were obtained by El-Mowafi et al.
(2005), Sedeak (2006), El-Said (2007) and Weerakoon et al (2008).
Table 3: The mean square estimates of all traits studied of canola using line x tester analysis.
S.O.V
D.F
M.S
Plant
Weight of
Seed yield
Oil yield
Oleic acid
height(cm)
1000(kg/fed)
(kg/fed)
level
seeds(gm)
Reps
2
0.34
2.32
1.86
2.70
0.76
Genotypes
13
40.32**
92.13**
36.12**
73.50**
7.13**
**
**
**
**
Parents
5
106.13
12.03
133.20
23.0
67.40**
**
**
**
**
Crosses
7
50.18
47.32
100.31
88.73
121.46**
P.VS.C
1
11.79**
15.86**
97.20**
13.46**
90.13**
Lines
3
28.03**
17.12**
10.37**
141.39**
20.32**
Testers
1
63.71**
20.13**
18.02**
40.0**
171.32**
Lines x
3
30.21**
107.32**
69.21**
30.82**
47.0**
Testers
Error
18
0.97
1.57
3.02
1.32
0.85
*Significant at 5%
**Significant at 1%
Linolenic
acid level
Linoleic acid
level
2.03
40.32**
20.18**
70.62**
100.17**
18.61**
80.43**
54.32**
1.59
60.12**
50.31**
8.13**
170.13**
15.32**
17.53**
19.32**
0.39
1.12
C. Heterosis:
The percentages of heterosis over better parents for all traits studied were showed in table (5). For plant
height, heterosis percentages were found to be significant and highly significant negatively in the crosses, P1 ×
P3, P1 × P6 and P2 × P4, while, the other crosses were positively for the same trait.
Table 4: The mean performance of all traits studied in canola using line x tester analysis.
Genotypes
Plant height
Weight of
Seed yield
Oil yield
Oleic acid
(cm)
1000-seed
(kg/fed)
(kg/fed)
level
(gm)
P1
120.37
3.14
1034.16
342.92
41.39
P2
110.61
3.72
1418.30
763.20
62.43
P3
130.72
3.22
1131.20
417.83
50.18
P4
127.0
2.94
1051.30
504.22
57.13
P5
118.66
3.17
1270.70
307.04
39.79
P6
104.30
3.84
1370.52
783.40
63.14
P1 × P3
95.40
3.76
1480.0
750.14
61.57
P1 × P4
133.18
2.83
1197.50
312.40
47.63
P1 × P5
126.40
3.12
1200.0
332.82
51.86
P1 × P6
100.21
4.32
1412.30
804.12
62.30
P2 × P3
134.19
3.24
1214.49
342.34
48.92
P2 × P4
106.70
3.92
1502.34
793.68
52.70
P2 × P5
124.30
3.40
1015.80
400.02
40.32
P2 × P6
105.39
4.15
1490.60
813.02
63.71
LSD at 5%
0.960
1.554
2.991
1.307
1.291
LSD at 1%
1.315
2.130
4.095
1.790
1.767
P1: B. napus (Denmark) Chine 1981.
P2: B. napus (serw 4), P3: B. napus (impulse) France 1998.
P4: B. napus (sakha 1), P5: B. napus (pactol) France.
P6: B. compestsis (torch) France 1980, *: Significant at 5%, **: significant at 1%
Linoleic acid
level
Linolenic
acid level
13.74
20.43
12.80
15.60
13.42
21.80
19.74
11.18
12.66
21.57
13.78
20.36
12.54
22.18
0.874
1.197
3.16
10.43
4.70
5.32
3.72
9.83
10.52
4.19
3.64
8.37
2.78
10.73
3.40
9.74
1.482
2.028
1655
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
The crosses; P1 × P3, P1 × P6 ,P2 × P4 and P2 × P6 were significantly and highly significantly positively
of heterosis over better parent for weight of 1000 – seeds, seed yield and oil yield in addition to the cross P1 ×
P4 for seed yield only, respectively.
While, the crosses, P1 × P3 for oleic acid, linoleic and linolenic acids, P1 × P5 for oleic acid level, P2 × P4
for linolenic acid level and P2 × P6 for linoleic acid level only were showed significantly and highly
significantly positively of heterosis over better parent similar results were observed by Singh and Kumar (2005),
Bindu et al (2006), El-Said (2007) and Weerakoon et al (2008).
Table 5: Percentages of heterosis over better-parent for all traits studied in canola.
Crosses
Plant height
Weight of
Seed yield
Oil yield
Oleic acid
Linoleic acid
Linolenic acid
(cm)
1000-seed
(kg/fed)
(kg/fed)
level
level
level
(gm)
**
**
**
**
**
**
P1 × P3
-20.14
16.77
30.83
79.53
22.69
43.66
123.83**
P1 × P4
10.64**
-9.87**
13.90**
-38.04**
-16.62**
-28.33
-21.24**
P1 × P5
6.52**
-1.57*
-5.56**
8.39**
25.29**
-7.86**
-2.15**
P1 × P6
-3.92**
12.79**
3.04*
2.64**
-1.33*
-1.05
-14.85**
P2 × P3
21.32**
-12.90**
-14.37**
-55.14**
-21.64**
-32.55**
-73.34
**
**
**
**
**
P2 × P4
-3.53
5.37
5.92
3.99
-15.58
-0.34
2.87**
P2 × P5
12.37**
-8.60**
-28.37**
-47.58**
-35.41**
-38.62**
-67.40**
P2 × P6
1.04*
8.35**
5.09**
3.78**
0.90
1.74**
-6.61
LSD at 5%
0.960
1.554
2.991
1.307
1.291
0.874
1.482
LSD at 1%
1.315
2.130
4.095
1.790
1.767
1.197
2.028
P1: B. napus (Denmark) Chine 1981,P2: B. napus (serw 4),P3: B. napus (impulse) France 1998,P4: B. napus (sakha 1),P5: B. napus (pactol)
France,P6: B. compestsis (torch) France 1980,*: Significant at 5%,**: significant at 1%
D. Combining ability:
D.1. General combining ability effects:
Estimates of (GCA) effects of individual parental lines for all traits studied of canola are presented in table
(6).
The parents; P1, P3 and P6 showed significantly and highly significantly negatively of (GCA) effects for
plant height and the same parents detected significantly and highly significantly positively for the other traits,
provided to be good combiners and the negative values of plant height means either short plant types or high
seed yield, could be useful for canola breeders who breed for short stature and highly levels of seed yield, oil
yield, oleic, linoleic and linolenic acids, respectively.
Table 6: Estimate of general combining ability effects for the parental varieties evaluated for all traits studied in canola using line × tester
analysis
Parents
Plant height
Weight of
Seed yield
Oil yield
Oleic acid
Linoleic acid
Linolenic acid
(cm)
1000-seed
(kg/fed)
(kg/fed)
level
level
level
(gm)
Testers
P1
-1.14**
1.93**
1.62**
2.63**
3.27**
5.18**
3.04**
P2
1.72**
-2.37**
-1.74**
-2.20**
-4.16**
-1.74
-6.39**
LSD at 5%
0.52
0.34
1.12
1.73
0.78
0.46
0.63
(gi)
LSD at
0.82
1.02
1.32
2.14
1.38
0.88
1.32
1%(gi)
P3(Lines)
-2.72**
4.06**
2.54**
4.13**
1.76**
2.17**
3.79**
P4
2.03**
-1.97**
-1.58**
-1.64**
-1.75**
-3.45**
-2.67**
P5
1.32**
-1.78**
-4.67**
-3.92**
-1.94**
-2.68**
-3.04**
P6
-0.73
3.02**
3.74**
1.88**
4.57**
2.13**
1.76**
LSD at 5%
0.79
1.03
1.12
0.68
1.00
0.47
0.32
(gi)
LSD at
1.34
1.43
1.56
1.12
1.54
0.92
0.67
1%(gi)
P1: B. napus (Denmark) Chine 1981,P2: B. napus (serw 4),P3: B. napus (impulse) France 1998,P4: B. napus (sakha 1),P5: B. napus (pactol)
France,P6: B. compestsis (torch) France 1980.
*: Significant at 0.05 level
**: significant at 0.01 level
D.2. Specific combining:
Significant and highly significant negative of (SCA) effects were showed in the crosses, P1 ×P3, P1 × P4,
P1 × P5 and P1 × P6 for plant height, while the same crosses were highly significantly and positively of (SCA)
effects for the other traits except the crosses, P1 × P5 for seed yield, P2 × P4 and P2 × P5 for oil yield which
1656
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
were highly significant negatively for the first cross and positively for the second and the third crosses,
respectively, in table (7).
These crosses were found to be useful for heterosis over better – parent and good combiners for the
breeders.
These results were in agreement with those reported by Bindu et al. (2006). Aidy (2006), Zhang et al.
(2007) and El-Mouhamady and Abdel sattar. (2012).
Table 7: Estimates of specific combining ability effects for the crosses evaluated for all traits studied in canola using line × tester analysis.
Crosses
Plant height
Weight of
Seed yield
Oil yield
Oleic acid
Linoleic acid
Linolenic acid
(cm)
1000-seed
(kg/fed)
(kg/fed)
level
level
level
(gm)
P1 × P3
-11.321**
17.324**
9.234**
6.813**
54.031**
16.731**
10.311**
P1 × P4
-7.032**
3.592**
13.201**
2.791**
1.943**
8.902**
20.0**
P1 × P5
-50.113**
23.021**
-19.304**
12.106**
37.011**
1.013**
1.723**
P1 × P6
-1.821**
7.806**
4.271**
1.401**
2.300**
11.072**
10.500**
**
**
**
**
**
**
P2 × P3
13.127
-8.492
-108.430
-12.025
-50.118
-1.432
1.721**
P2 × P4
9.137**
-2.602**
-20.121**
30.274**
-4.031**
-60.431**
-10.30**
P2 × P5
1.632**
-13.204**
-70.492**
21.132**
-12.402**
-6.321**
-7.359**
P2 × P6
12.621**
-4.390
-43.021**
-27.104**
-8.431**
-14.211**
-5.034**
LSD at
0.410
1.329
0.231
0.579
0.134
0.430
0.680
5%(SIJ)
LSD at
1.207
2.034
0.806
1.031
0.602
0.973
1.314
1%(SIJ)
P1: B. napus (Denmark) Chine 1981,P2: B. napus (serw 4),P3: B. napus (impulse) France 1998,P4: B. napus (sakha 1),P5: B. napus (pactol)
France,P6: B. compestsis (torch) France 1980,*: Significant at 0.05 level,**: significant at 0.01 level
E. Correlation coeffients:
The result in table (8), revealed that, highly significant positively of correlations coeffieients were found
between seed yield and weight of 1000 – seeds, oil yield, oleic, linoleic and linolenic acid levels, while, it was
highly significant and negatively between plant height and the same traits. These results were in agreement with
those reported Jana et al (2000) Aidy et al. (2006) and Abdel sattar and El-Mouhamady (2012).
Notes:
P1 :- Brassica . napus (Chine 1981)
P2 :- Brassica . napus (Serw 4)
P3 :- Brassica . napus (Impulse)
P4 :- Brassica . napus (Sakha 1)
P5 :- Brassica . napus (Pactol)
P6 :- Brassica . compestsis (Torch)
Table 8: Phenotypic correlation coefficients between all traits studied in canola.
Traits
Plant height
Weight of
Seed yield
Oil yield
(cm)
1000-seed
(kg/fed)
(kg/fed)
(gm)
Plant height (cm)
1
-0.724**
-0.421**
-0.804**
Weight of -1000-seed (g)
1
0.344**
0.509**
Seed yield (kg/fed)
1
0.463**
Oil yield (kg/fed)
1
Oleic acid level
Linolenic acid level
Linoleic acid level
*: Significant at 0.05 level
**: significant at 0.01 level
Oleic acid
level
Linolenic
acid level
Linolec
acid level
-0.503**
0.293**
0.648**
0.914**
1
-0.613**
0.780**
0.320**
0.613**
0.652**
1
-0.314**
0.342**
0.570**
0.443
0.702**
0.732**
1
Estimates of GAC, SCA effects and heterosis over better – parent of the 14 canola genotypes were
calculated for all studied traits and presented in tables (5, 6, 7). Several crosses exhibited desirable SCA effects
for the studied traits. The superior crosses, showing desirable SCA effects for short stature and the other traits
were obtained from the crosses, P1 × P3, P1 × P6, P2 × P4 and P2 × P6, which indicated that these crosses could
be used in breeding program as short stature donors either under stress or non-stress conditions, depending on
their non-additive gene effect for heterosis over better parent and (SCA) effects.
Considering the (GCA) effects of different traits, it was suggested that population involving the parents;
(P2, P3, P4 and P6) could be considered in making multiple crossing because they might possess desirable
genes for short stature as well as high seed yielding and the other unsaturated fatty acids. Accordingly. These
parents would be the best choice as base populations.
1657
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
These findings indicated that the intrinsic performance of these parent all lines gave a good index of their
(GCA) effects. Therefore, selection for improving such traits could be practiced either mean performance or
(GCA) effects basis.
The population would posses desirable genetic for seed yield, oil yield, oleic, linoleic and linolenic acids
levels.
Also, this different origin of these parents would widen the genetic base for selection. These results were in
agreement with those reported by Abdel-Gawad et al. (1990), Chauhan et al. (1992), Ahmed et al., (1998), Brar
et al. (1998), Afiah et al. (1999), Hammad et al. (1999) and Ali and Hassan (2002).
The results in figures (1, 2, 3, 4) revealed that the highest level of seed yield was related with increasing the
levels of oil yield, oleic, linoleic and linolenic fatty acids, respectively, specially in crosses between the parents
of canola. It is important to notice that, the greatest trend of increasing in aleic, linoleic and linolenic fatty acids
will due to increase the oil quality of canola plants.
Fig. 1: The relationship between seed yield and oil yield.
Fig. 2: The relationship between seed yield and oleic level fatty acid.
1658
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
Fig. 3: The relationship between seed yield and linoleic level fatty acid.
Fig. 4: The relationship between seed yield and linolenic level fatty acid.
F. molecular markers:
F.1. SDS-Protein electrophoresis:
The electrophoretic banding patterns of proteins extracted from the leaves of canola parents are shown in
(Fig. 5 and table 9).
Twelve bands ranging from 5 to 140 (KDa) were polymorphic with 80% polymorphism and were used to
compare between six genotypes of canola. The results showed that the bands number 2, 3, 5, 6, 7, 8, 10, 11 and
12 with molecular weight of 135, 130, 120, 80, 65, 50, 30, 10 and 5KDa were appeared in all parents,
respectively, while, the bands number 1, 4 and 9 with molecular weight of 140, 125 and 35 KDa were observed
in all parents except the bands number (1, 9) for the parent number 4 and the band number 4 for the parent
number 3, respectively.
These results indicated that these bands were specific markers for synthetic protein linked to classification
these cultivars of canola. These findings were reported by Shinozak et al. (2007).
1659
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
Fig. 5: SDS-PAGE of water soluble protein fraction for the six parents of canola.
F2. RAPD-PCR markers:
RAPD-PCR patterns revealed that primer AAU-B9 succeeded in exhibiting RAPD bands that can be used
indistinguishing between the six parents of canola (Fig. 6 and table 10).
All bands were appeared in all parents except the bands number 4 with molecular weight of 2000 bp wasn't
appear in the parents number 1 and 3, the bands number 5 and 6 with molecular weights of 1500 and 1100 bp
weren't appear in the parents (P1, P6) for the first band and P5 for the second band, respectively, while, the
bands number 1, 2, 3, 7, 8 and 9 with molecular weight of 3000, 2350, 2300, 650, 450 and 200 bp were common
bands in the six parents of canola.
Fig. 6: Agarose gel electrophoresis of RAPD-PCR reaction for random primer AAU-B9 for DNA samples of
the six parents of canola.
Table 9: The protein banding, patterns for the six parents of canola.
Band No.
(Mw) (KDa)
P1
P2
P3
1
140
1
1
1
2
135
1
1
1
3
130
1
1
1
4
125
1
1
0
5
120
1
1
1
6
80
1
1
1
7
65
1
1
1
8
50
1
1
1
9
35
1
1
1
10
30
1
1
1
11
10
1
1
1
12
5
1
1
1
Total of Bands
12
12
11
P1):- Brassica napus (Denmark) Chine 1981, P2):- Brassica napus (serw 4)
P3):- Brassica napus (impulse) France 1998, P4):- Brassica napus (sakha 1)
P5):- Brassica napus (pactol) France , P6):- Brassica compestsis (torch) France 1980
P4
0
1
1
1
1
1
1
1
0
1
1
1
10
P5
1
1
1
1
1
1
1
1
1
1
1
1
12
P6
1
1
1
1
1
1
1
1
1
1
1
1
12
1660
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
Table 10: The densitometric analysis of RAPD-PCR products of the six parents of canola using AAU-B9 primer.
Band No.
Base pairs
P1
P2
P3
P4
P5
1
3000
1
1
1
1
1
2
2350
1
1
1
1
1
3
2300
1
1
1
1
1
4
2000
0
1
0
1
1
5
1500
0
1
1
1
1
6
1100
1
1
1
1
0
7
650
1
1
1
1
1
8
450
1
1
1
1
1
9
200
1
1
1
1
1
P1):- Brassica napus (Denmark) Chine 1981, P2):- Brassica napus (serw 4)
P3):- Brassica napus (impulse) France 1998, P4):- Brassica napus (sakha 1)
P5):- Brassica napus (pactol) France , P6):- Brassica compestsis (torch) France 1980
P6
1
1
1
1
0
1
1
1
1
The results in (Fig. 7 and table 11). Showed that the bands number 1, 2, 3, 5, 6 and 7 with molecular weight
of 2500, 2000, 1500, 450, 350 and 250 bp, respectively, were appeared in all parents of canola using AAU-B10
primer, which indicated that these bands were common bands in these cultivars, while, the bands number 3 with
molecular weight of 1500 bp wasn't appear in the parent number 5, the band number 4 with molecular weight of
550 bp was appear in parent (5) only and the band number 8 with molecular weight of 150 bp was appear in
parents (1 and 2), respectively, which means that these three bands played an important role to identify these
parents and may be markers in these cultivars.
Fig. 7: Agarose gel electrophoresis of RAPD-PCR reaction for random primer AAU-B10 for DNA samples of
the six parents of canola.
RAPD-PCR bands produced by AAU-B11 primer are presented in (Fig. 8 and table 12):
The results showed that the bands number 2, 3, 6, 7 and 8 with molecular weight of 2300, 1700, 600, 300
and 200 bp were appeared in all the parents of canola, respectively which indicated that these bands were
common bands in these cultivars.
On the other hand, the band number 1 with molecular weight of 2800 bp wasn't appear in the parents
number 3 and 4, while, the band number 4 with molecular weight of 1000 bp was appeared in the parents 4 and
6 only and it was not appeared in the parents 3 and 5 ,the band number 5 with molecular weight of 750 bp was
not appeared olso in the parent 6,respectively.
In addition to the bands number 5 and 9 with molecular weight of 750 and 100 bp were appeared in all
parents except the parents (6) for the first band and the parents (3 and 4) for the second band respectively.
Finally, nine bands played an importance role to classification and distribution of the molecular weights from
100 to 2800 bp as well as the absence of some band number ensure that these cultivars are different in origen,
moreover some band number were gather and maybe marker in these cultivars. These results were in conformity
with those reported by El-Baz et al. (2003) and Al-Waibi (2010).
1661
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
Fig. 8: Agarose gel electrophoresis of RAPD-PCR reaction for random primer AAU-B11 for DNA samples of
the six parents of canola.
Table 11: The densitometric analysis of RAPD-PCR products of the six parents of canola using AAU-B10 primer.
Band No.
Base pairs
P1
P2
P3
P4
P5
1
2500
1
1
1
1
1
2
2000
1
1
1
1
1
3
1500
1
1
1
1
0
4
550
0
0
0
0
1
5
450
1
1
1
1
1
6
350
1
1
1
1
1
7
250
1
1
1
1
1
8
150
1
1
0
0
0
P1):- Brassica napus (Denmark) Chine 1981, P2):- Brassica napus (serw 4)
P3):- Brassica napus (impulse) France 1998 ,P4):- Brassica napus (sakha 1)
P5):- Brassica napus (pactol) France , P6):- Brassica compestsis (torch) France 1980
Table 12: The densitometric analysis of RAPD-PCR products of the six parents of canola using AAU-B11 primer.
Band No.
Base pairs
P1
P2
P3
P4
P5
1
2800
1
1
0
0
1
2
2300
1
1
1
1
1
3
1700
1
1
1
1
1
4
1000
0
0
0
1
0
5
750
1
1
1
1
1
6
600
1
1
1
1
1
7
300
1
1
1
1
1
8
200
1
1
1
1
1
9
100
1
1
0
0
1
P1):- Brassica napus (Denmark) Chine 1981 ,P2):- Brassica napus (serw 4)
P3):- Brassica napus (impulse) France 1998 ,P4):- Brassica napus (sakha 1)
P5):- Brassica napus (pactol) France ,P6):- Brassica compestsis (torch) France 1980
P6
1
1
1
0
1
1
1
0
P6
1
1
1
1
0
1
1
1
1
F.3. Specific-PCR markers:
The results in Fig. (9) revealed that the band number six with molecular weight of 600 bp were showed in
all parents using (GT-1) primer as index for oleic fatty acid, while, the band number three with molecular
weight of 1250 bp using (GT-2) primer were observed in all parents for linoleic fatty acid in Fig. (10).
Fig. 9: The densitometric of specific-PCR using GT-1 primer for oleic fatty asid in the six parents of canola.
On the other hand, the bands number (2, 7 and 8) with molecular weights of (1350, 650, 350) bp were
revealed in the parents; (P5, P6), (P1, P2, P3) and (P4), respectively using (GT-3) primer for linolenic fatty acid
1662
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
in Fig. (11), which indicated that these bands were specific markers for highly level of (oleic, linoleic and
linolenic) fatty acids, so, the long chain unsaturated fatty acids specially oleic, linoleic, linolenic and omega
fatty acids (eicosapentaenoic acid (EPA) and docosahexacnoic acid (DHA) have beneficial cardiovascular and
anti-inflammatory properties.
Fig. 10: The densitometric of specific-PCR using GT-2 primer for oleic fatty asid in the six parents of canola.
More recently, attention has been given to the possibility that the precursor omega-3 PUFA, Alpha linolenic
acid (ALNA), may share some of the beneficial actions of EPA/DHA on human health conjugated linoleic acid
(CLA), which arises as a metabolic by product of rumen hydrogenation and which is found in foods of animal
origin, has been proposed to possess potent health promoting properties. There is an urgent need for
complementary studies in human volunteers, to confirm the putative anti-carcinogenic, anti-atherogenic, antilipogenic and immune-uppressive properties of CLA. Similar results were reported by Al-Waibi (2010).
Fig. 11: The densitometric of specific-PCR using GT-3 primer for oleic fatty asid in the six parents of canola.
F.4. Genetic Distances:
The ratio of genetic similarity among the six varieties of canola ranged from 0.653 to 0.996 (table 13). The
highest similarity was obtained between (P1 and P2), (P3 and P4) and (P2 and P6), which were (0.996), 0.932
and (0.875), respectively, while, the lowest level of similarity (0.653)% was obtained between (P3 and P5).
In this study, the highest value of genetic similarity is relatively low when compared to the reports of other
RAPD studies genetic similarity among traditional and improved cultivars (Jaccord's similarity coefficient)
indicating an arrow genetic base in the improved varieties of canola.
Table 13: Genetic distances among canola verities based on the (RAPD-PCR) data.
Parents
P1
P2
P3
P1
1
0.956
0.869
P2
0.996
1
0.833
P3
0.869
0.850
1
P4
0.791
0.840
0.932
P5
0.763
0.800
0.659
P6
0.820
0.875
0.720
P1):- Brassica napus (Denmark) Chine 1981 , P2):- Brassica napus (serw 4)
P3):- Brassica napus (impulse) France 1998 , P4):- Brassica napus (sakha 1)
P5):- Brassica napus (pactol) France, P6):- Brassica compestsis (torch) France 1980
P4
0.791
0.847
0.909
1
0.680
0.793
P5
0.760
0.812
0.653
0.693
1
0.813
P6
0.833
0.875
0.720
0.794
0.743
1
F.5. Cluster analysis:
Dendogram was constructed based on Nei and Li's (1979) genetic distance using Jaccard cluster analysis
and depicted genetic relationships among six canola varieties showing one major cluster of protein marker (Fig,
12) I.As expected all introduced six parents of canola, were grouped into a cluster, including four sub clusters in
astrait line. The first group was P4 (Brassica napus-sakha1) and the other parents (P1, P2, P5 and P6) in astrait
line, while, the cluster in (Fig., 13) included one –cluster ,two sub-cluster and one sub-sub -cluster namely (P4,
1663
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
6.4
P6), (P3, P4), (P1, P2) and (P1, P6), respectively, with the highest genetic similarity 99% of RAPD-PCR
products.
5.6
D
4.8
C
3.2
4
F
2.4
A
1.6
B
0.8
0.825
0.85
0.875
0.9
0.925
0.975
Similarity
0.95
0
0.8
E
6.4
Fig. 12: Dendogram of the six parents of canola namely, A(Brassica napus-denmark-chine-1980),B(Brassica
napus-serw 4),C(Brassica napus-impulse-france-1998),D(Brassica napus-sakha 1),E(Brassica napuspactol france) and F(Brassica compestsis-torch –france-1980), respectively showing genetic distances
using cluster analysis for protein banding patterns.
5.6
E
4.8
D
3.2
4
C
2.4
A
1.6
B
0.72
0.75
0.78
0.81
0.84
0.87
0.9
0.93
0.96
0.99
0
0.8
F
Similarity
Fig. 13: Dendogram of the six parents of canola namely, A(Brassica napus-denmark-chine-1980),B(Brassica
napus-serw 4),C(Brassica napus-impulse-france-1998),D(Brassica napus-sakha 1),E(Brassica napuspactol france) and F(Brassica compestsis-torch –france-1980), respectively showing genetic distances
using cluster analysis for RAPD-PCR products.
Also, the dendo gram indicates a clear pattern of division among the canola varieties based on geographic
origin of the varieties. Therefore, the analysis clearly, distinguished among studied of canola varieties such
1664
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
studied can be used to study the genetic differences of cultivars for their identification. Therefore it might be
predicted that PAPD-PCR may be effective in analyzing polymorphism at the subspecies level in genes
(Brassica napus L.).In the present study RAPD markers provided sufficient resolution to distinguish closely
related varieties.
References
Abdel Sattar, A.A. and A.A. El-Mouhamady, 2012. Genetic analysis and molecular markers for yield and its
components traits in faba bean(Vicia Faba L.).Australien journal of Basic and applies sciences, 6(7): 458466.
Abdel-Gawad, A.A., A. El-Tabbakh, A.M. Abo-Shetaia and M.CO. El-Baz, 1990. Effect of nitrogen
phosphorous and potassiym fertilization on the yield and yield components of rape plant. Annals
Agric.SCI., Ain-Shams Univ., Cairo, Egypt, 35(10): 279-293.
Afiah, S.A.N., H.A. Sallam and N.M. Mahrous, 1999. Screening Canola (Brassica Napus L.) varieties for yield
and its attributes in relation to chemical constituents under saline conditions. Annals. Agric. Sci., AinShams Univ., cairo, 44(1): 227-246.
Ahmed, A., G. Abrahim, N. Gandotra, Y.P. Abrol and M.Z. Abdin, 1998. Interaction effect of nitrogen and
sulphur on growth and yield of rape-seed-mustard (Brassica Napus L.) czern and coss. and Brassica
campestris L.) Genotypes Journal of Agronomy and crop science, 181(4): 193-199.
Aidy, I.R., M.Z. Abd El-Kareem, A.H. Glelah, E.M. El-Shreaf and S.E. Seddek, 2006. Combining ability and
heterosis for yield and some physiological traits in rice (Oryza sativa L.). The first field Crops Conference,
Agric. Res. Cent., Egypt.
Ali, E.A. and A.E. Hassan, 2002. Anatomical structure, chemical constituets, yield affected by nitrogen and
potassium fertilization. Egypt. J. Appl. Sci., 17(10): 176-197.
Al-Whaibi, M.H., 2010. Plant heat-shock proteins: Amini review. Journal of king saud univ. (science), doi:101016-J.JKSUS,2010-06.022.
Bindu, K.H. and H.E. Shashidhear, 2006. Genetic analysis of growth and root traits in Japonica/Indica cross,
Department of Genetics and Plant Breeding University of Agricultural Sciences and Indian Institute of
Horticultural Research, India, 31(2): 51-52.
Brar, Z.S., D.S. Bal and A.S. Johl, 1998. Influence of sowing dates,nitrogen and planting geometry on the
performance of gobhi sarson9(Brassica napus subsp.Oleifera Var.annua). Indian Journal of Agronomy,
43(1): 133-137.
Chauhan, A.K., M. Singh, K.S. Dadhwal and M. Singh, 1992. Effect of nitrogen level and row spacing on the
performance of rape seed (Brassica Napus L.) Indian Journal of Agronomy, 37(4): 851-853.
El-Baz, F.K., A.A. Mohamed, A.A. Aloy, 2003. Development of Biochemical markers for salt stress tolerance
in cucumber plants,Pakistan journal of biological science, 6: 16-22.
El-Mowafi, H.F., A.O. Bastawisi, M.I. Abo Youssef and F.U. Zaman, 2005. Exploitation of rice heterosis under
Egyptian conditions. Egyptian J. Agric. Res., 83(5A): 143-167.
El-Said, A.M., 2007. Genetical and molecular breeding for drought tolerance in Rice, Department of Genetics,
Faculty of Agriculture, Kafr El-Sheikh University.
Fieller, E.C., T. Lewis, E.S. Pearson, 1957. Correlated Random normal deviates.tracts for computers,
NO.XXVI. Cambridge Univ, press.
Graham, C.S., T.H. Tseng and C. Henry, 1997. Inheritance of fertility restoration of cytoplasmic male sterility in
Indica rice. Rice Genetics. Proceedings of the Int. Rice Genetics Symposium, 27-31 May, 1985 Manila,
Philippines, 649-654.
Hammad, K.M. and G.M. El-shebiny, 1999. Optimization of canola seed yield(Brassica Napus L.). under
calcareous soil condition. J. Agric. Sci., Mansoura Univ., 24(11): 7071-7084.
IRRI, 2005. IRRISTAT for Windows, V6. Manila, Philippines. International Rice Research Institute.
Jana, P.K., D. Dutta and D. Maity, 2000. Performance of pair grasspea (Lathyrus sativus L.) as influenced by
residual effect of treamten s applied to dual culture (rice + prawn). Indian Agriculturist, 44(7): 83-85.
Laemmli, U.K., 1970. Cleavage of structure proteins during the assembly of the head of baceriophage T4.
Nature, 227: 680-685.
Legendre, P., L. Legendre, 1998. Numerical ecology, 2nd English edn. Elsevier, Amsterdam.
Mccune, B. and J.B. Grace, 2002. Analysis of Ecological communities. MJM press (publishers), pp: 45-57.
Nei, M., W.H. Li, 1979. Mathematical model for studying genetic variation in terms of restriction
endonucleases. Proc. Natl. Acad. Sci., 76: 5269-5273.
Rousseeuw, P.J. and L. Kaufman,1990. Finding Groups in data: An introduction to cluster Analysis. Wiley.
New York.
1665
J. Appl. Sci. Res., 9(3): 1651-1665, 2013
Sajbidor, J.M., Lamacka, J. Cista and M. Certik, 1994. "EFFECT OF SALT STRESS ON FATTY-ACID
ALTERATIONS IN SOME STRAINS OF DIPODASCOPSIS AND DIPODASCUS SPP", World journal
of microbiology & biotechnology, 10(2): 184-186.
Sedeek, S.E.M., 2006. Breeding studies on rice. PH.D. Thesis, Faculty of Agriculture, Kafr El-Sheikh, Tanta
University, Egypt.
Sharma, N., H.E. Shashildhor and S. Hittalmani, 2003. Root leneth specific scar marker in rice (oryza sativa L.)
. Rice genetics news letter, 19: 47-48.
Shinozaki, K. and K.Y. Shinozaki, 2007. Gene networks involved in drought stress response and tolerance. J.
Experimental Botany, 58(2): 221-227.
Singh, N.K. and A. Kumar, 2005. Combining ability analysis to identify suitable parents for heterotic rice
hybrid breeding. International Rice Research Newsletter, 29(1): 21-22.
Studier, F.W., 1973. Analysis of bacteriophage T7 early RNas and proteins of slab gels. J. Mol. Biol., 79: 237248.
Virmani, S.S., B.C. Viraktamath, C.L. Cassal, R.S. Toledo, M.T. Lopez and J.O. Manalo, 1997. Hybrid Rice
Breeding Manual, International Rice Research Institute.
Weerakoon, W.M.W., A. Maruyama and K. Ohba, 2008. Impact of humidity on temperature induced grain
sterility in rice (Oryza sativa L.). Rice Research and Development Institute, Bata lagoda, Ibba gamuwa, Sri
Lanka; Journal of Agronomy and Crop Science, 194(2): 135-140.
Williams, K.T., J.G. Real, M.A. Maguling, M.A. Obien and G.C. Loresto, 1990. Comparison of selection
indices to screen lowland rice for drought resistance. Euphatica, 48: 253-260.
Wyanne, J.C., D.A. Emery and P.W. Rice,1970. Combining ability estimates in Arachis hypogea L. II- Field
Performance of F1 hybrids. Crop Sci., 10.
Zhang, Bin, Wenyi and Wi Jian-Zhang, 2007. Responses of pollen activity and seed setting of rice to high
temperature of heading period, ministry of Agriculture, Non Jing Agricultural University, China, 33(7):
1177-1181.
Fly UP