...

STRUTTURA E FUNZIONE DEL GENE

by user

on
Category: Documents
5

views

Report

Comments

Transcript

STRUTTURA E FUNZIONE DEL GENE
STRUTTURA
E FUNZIONE
DEL GENE
Dott. Davide Barbagallo
DIP. SC. BIOMEDICHE, UNIVERSITA’ DEGLI STUDI DI CATANIA
COMPARATIVE SCALE OF MAPPING (RIASSUNMENDO
LA STRUTTURA DEL DNA)
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGTT
AAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTACT
GGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTAG
TCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAATC
CTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACCA
TAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTAT
TGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAGT
AGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCTCT
GGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAGAA
ATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTCTT
CTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCAGA
ACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGAGA
AAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCTCT
GCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACAAA
GCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGA
GACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCT
GGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATG
ATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATGAC
TTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATC
TGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCG
ATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGG
CATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAG
GGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTC
TCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAA
ATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAG
RICAPITOLIAMO ALCUNE DEFINIZIONI
GENOMA: INFORMAZIONE GENETICA TOTALE DI UNA CELLULA O DI UN
ORGANISMO (Da Lodish – Molecular Cell Biology)
GENE: UNITA’ FISICA E FUNZIONALE DELL’EREDITA’, CHE TRASPORTA
L’INFORMAZIONE DA UNA GENERAZIONE ALLA SUCCESSIVA. IN
TERMINI “MOLECOLARI” E’ L’INTERA SEQUENZA DI DNA (INCLUSI
ESONI, INTRONI E REGIONI DI CONTROLLO TRASCRIZIONALE NON
CODIFICANTI) NECESSARIA ALLA PRODUZIONE DI UNA PROTEINA
FUNZIONANTE O DI RNA
(Da Lodish – Molecular Cell Biology)
LOCUS GENICO: SITO CROMOSOMALE OVE E’ LOCALIZZATO UN GENE
ORGANIZZAZIONE GENICA (H. sapiens)
SEGMENTO DI 50 Kb DEL CROMOSOMA 7 FACENTE PARTE DEL LOCUS DEL
“RECETTORE UMANO β DELLE CELLULE T”
MICROSATELLITI (STR)
SEGMENTI
GENICI
CODIFICANTI
PER UNA PARTE
DELLA PROT.
RECETTORE
β DELLE CELL.
T
PSEUDOGENE
(CORRELATO
CON I MEMBRI
FUNZIONALI
DELLA FAMI=
GLIA GENICA
DEL TRIPSINOGENO)
RIPETIZIONI
DISPERSE
IN TUTTO
IL GENOMA
(LINEs;
SINEs; LTR E
TRASPOSONI
A DNA)
GENE PER IL TRIPSINOGENO
ORGANIZZAZIONE GENICA (H. sapiens) (continua)
NOTA:
NOTA INFINE, APPROSSIMATIVAMENTE IL 50%
DEL SEGMENTO CONSIDERATO E’FATTO DI
TRATTI DI DNA A FUNZIONE O SIGNIFICATO
IGNOTO, NON GENICI, NON RIPETITIVI E A
SINGOLA COPIA.
ORGANIZZAZIONI GENOMICHE
UOMO
EUCARIA
E.COLI
PROCARIA
IL GENOMA È FATTO SOLO DI GENI?
Genoma
Umano
~80%
~20%
(64% del genoma totale)
~80%
~6%
(1,2% del genoma totale)
~94%
(18,8% del genoma totale)
(16% del genoma totale)
~20%
Il genoma è fatto solo di geni?
Anatomia del Genoma Umano
IL GENE NEI PROCARIOTI
• GENOMA DEI PROCARIOTI PIUTTOSTO COMPATTO;
• GENI CONTINUI (DIMENSIONE MEDIA DEL GENE CA. 1Kb);
• GENI IN GENERE RAGGRUPPATI IN CLUSTERS (OPERONI) SOTTO IL
CONTROLLO DI UN UNICO PROMOTER:
NOTA:
NOTA LA SPAZIATURA TRA LE DUE REGIONI DEL PROMOTER E’ IMPORTANTE PERCHE’
COLLOCA I DUE DOMINI SULLA STESSA FACCIA DELLA DOPPIA ELICA, FACILITANDO LA
LORO INTERAZIONE CON LA SUBUNITA’ σ DELLA RNA-POLIMERASI CHE SI LEGA AL DNA
GENE PROCARIOTICO
OPERONE
Sequenze regolatrici a monte
Sequenze codificanti
Sequenze terminatrici
della sequenza codificante
NOTA:
NOTA L’OPERATORE E’ UNA SEQUENZA SPECIFICA DI DNA CUI POSSONO LE=
GARSI PROTEINE A FUNZIONE DI ATTIVATORI O DI REPRESSORI DELLA TRA=
SCRIZIONE! SOLITAMENTE ESSO E’ POSIZIONATO ADIACENTEMENTE AL
PROMOTER CHE REGOLA L’INIZIO DELLA TRASCRIZIONE DELL’OPERON.
IL CONTROLLO DELL
DELL’’ESPRESSIONE GENICA DEI
PROCARIOTI
DI NORMA IL CONTROLLO DELL’ESPRESIONE DEI GENI NEI PROCARIOTI E’
DI TIPO NEGATIVO, VALE A DIRE AL PROMOTORE SONO NORMALMENTE LE=
GATE DELLE PROTEINE CHE IMPEDISCONO FISICAMENTE ALLA RNA-POLI=
MERASI DI CONTATTARE IL DNA E, QUINDI, LA TRASCRIZIONE NON PUO’
MATERIALMENTE AVERE INIZIO.
IL GENE NEGLI EUCARIOTI:
IL CASO PIU’
PIU’ COMPLESSO
1) GENI DI CLASSE I
CODIFICANO PER RNA RIBOSOMALI (rRNA)
28S; 18S; 5.8S
2) GENI DI CLASSE II
CODIFICANO PER RNA MESSAGGERI (mRNA) E
PER MOLTI SMALL NUCLEAR RNA (snRNA)
3) GENI DI CLASSE III
CODIFICANO PER RNA RIBOSOMALI (rRNA)
5S; PER RNA TRANSFER (tRNA); PER I
RIMANENTI snRNA
CARATTERISTICHE GENERALI DEL
GENE EUCARIOTICO
• VENGONO TRASCRITTI AD OPERA DI RNA POL. DIVERSE: RNA POL I; II E III
( LE QUALI NON “CONTATTANO” DIRETTAMENTE CON IL DNA, MA NECESSI=
TANO DI “FATTORI PROTEICI ACCESSORI” CHE LE “GUIDINO” PER FAR CIO’);
• GENI DISCONTINUI;
• PROMOTERS COMPLESSI;
• SOLO RARAMENTE SOVRAPPOSTI;
• POSSONO PRESENTARE ENHANCERS;
• SONO SOGGETTI A SPLICING;
• TALORA MOSTRANO TESSUTO-SPECIFICITA’
GENI DI CLASSE II
GENE EUCARIOTICO
GENE EUCARIOTICO
GENE EUCARIOTICO
GENE EUCARIOTICO
GENE EUCARIOTICO
Promotore
IL GENE NEI PROCARIOTI
• GENOMA DEI PROCARIOTI PIUTTOSTO COMPATTO;
• GENI CONTINUI (DIMENSIONE MEDIA DEL GENE CA. 1Kb);
• GENI IN GENERE RAGGRUPPATI IN CLUSTERS (OPERONI) SOTTO IL
CONTROLLO DI UN UNICO PROMOTER:
NOTA:
NOTA LA SPAZIATURA TRA LE DUE REGIONI DEL PROMOTER E’ IMPORTANTE PERCHE’
COLLOCA I DUE DOMINI SULLA STESSA FACCIA DELLA DOPPIA ELICA, FACILITANDO LA
LORO INTERAZIONE CON LA SUBUNITA’ σ DELLA RNA-POLIMERASI CHE SI LEGA AL DNA
GENE EUCARIOTICO
Promotore
I PROMOTERS DI GENI DI CLASSE II
Inr : Py2CAPy5
SEQUENCE ELEMENTS WITHIN A TYPICAL
EUKARYOTIC GENE1
octamer
transcription
element
+1
promoter
ATTTGCAT
GC
CAAT
GC
TATA
-130
-95
-80
-50
-25
TATA box (TATAAAA)
• located approximately 25-30 bp upstream of the +1 start site
• determines the exact start site (not in all promoters)
• binds the TATA binding protein (TBP) which is a subunit of TFIID
GC box (CCGCCC)
• binds Sp1 (Specificity factor 1)
CAAT box (GGCCAATCT)
• binds CTF (CAAT box transcription factor)
Octamer (ATTTGCAT)
based on the thymidine kinase gene
• binds OTF (Octamer transcription factor)
1
GLI ENHANCERS
• SONO ELEMENTI CHE INCREMENTANO L’ATTIVITA’ DI UN PROMOTER;
• LA LORO POSIZIONE RISPETTO AL PROMOTER PUO’ VARIARE DI MOLTO;
• POSSONO FUNZIONARE IN QUALUNQUE ORIENTAMENTO;
• FONDAMENTALE DIFFERENZA CON UN TIPICO PROMOTER E’ LA DENSITA’
DEGLI ELEMENTI REGOLATORI (RISPETTO AGLI ELEMENTI DEL PROMOTER,
QUELLI DEGLI ENHANCERS SONO PIU’ BREVI MA PIU’ STRETTAMENTE
RAGGRUPPATI);
• POSSONO CONTRIBUIRE ALLA TESSUTO-SPECIFICITA’ DELL’ESPRESSIONE
GENICA
GLI ENHANCERS
ALTRI ELEMENTI CARATTERISTICI DEL GENE
NOTA:
NOTA SPESSO LA PRE=
SENZA DI CpG ISLAND
IN PROSSIMITA’ DI UN
PROMOTER E’ INDICE
DELLA PRESENZA DI UN
GENE!
GENE EUCARIOTICO
Sequenza
codificante
modulare
GENE EUCARIOTICO
Segnale di
poliadenilazione
GENE EUCARIOTICO
Può un gene codificare per diverse proteine?
GENE EUCARIOTICO
Può un gene codificare per diverse proteine?
X
GENE EUCARIOTICO
Può un gene codificare per diverse proteine?
GENE EUCARIOTICO
GENE EUCARIOTICO
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC
TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT
ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG
CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA
CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA
ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA
AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC
AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA
CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA
CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC
AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG
AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC
CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC
CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA
GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG
TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG
AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC
CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA
CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG
GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC
AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC
AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT
ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT
CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA
GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA
AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG
CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT
ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA
TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC
TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC
ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGT
TAAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTAC
TGGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTA
GTCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAAT
CCTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACC
ATAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTA
TTGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAG
TAGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCT
CTGGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAG
AAATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTC
TTCTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCA
GAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGA
GAAAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCT
CTGCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACA
AAGCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCA
GAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAG
CTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGA
TGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATG
ACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTC
ATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGC
CCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTG
TGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAG
AAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCA
GTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGA
AAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCG
AG
GENI DI CLASSE I
GENI DI CLASSE I
1) SONO I GENI CHE CODIFICANO PER GLI rRNA 28S; 18S E 5.8S;
2) SONO ORGANIZZATI IN CLUSTER
CHE SPESSO SI RIPETONO IN
TANDEM;
3) CITOGENETICAMENTE SONO DI=
SPOSTI IN REGIONI CROMOSOMALI
SPECIFICHE CHE CONVERGONO IN
UNA SUB-STRUTTURA NUCLEARE
NOTA COME NUCLEOLO
PROMOTERS DEI GENI DI CLASSE I
• PRESENTANO SCARSA VARIABILITA’;
• CONSISTONO IN UNA SEQUENZA BIPARTITA NELLA REGIONE CHE PRECEDE
IL PUNTO DI INIZIO: SI DISTINGUONO UN NUCLEO DEL PROMOTER (-45/+20)
ED UN UCE (UPSTREAM CONTROL ELEMENT) (-180/-107);
• ENTRAMBE LE REGIONI SONO PARTICOLARMENTE RICCHE IN GC;
• PERCHE’ LA TRASCRIZIONE INIZI, DAPPRIMA SI LEGANO DUE FATTORI:
UBF1 ED SL1 (TBP + 3TAFs I) E SOLO DOPO SI LEGA LA POL I
PROMOTER DI GENI DI CLASSE I:
PIC
MATURAZIONE DEGLI rRNA EUCARIOTICI
LA SINTESI DEL
PRECURSORE DEGLI
rRNA 28S, 18S E 5.8S È UNA
GRANDE MOLECOLA
(PRE-rRNA 45S)
TRASCRITTA DALLA RNA
POL I NEL NUCLEOLO.
ANCHE LA MATURAZIONE
AVVIENE NEL NUCLEOLO.
NUMEROSI PICCOLI RNA
NUCLEOLARI (snoRNA)
PARTECIPANO AL PROCESSO
GENI DI CLASSE III
GENI DI CLASSE III
1) CODIFICANO PER I tRNA; PER L’rRNA 5S E PER VARI
snRNA;
2) POSSONO PRESENTARE DEI PROMOTERS “INTERNI” (ICR);
3) PRIMA DI INIZIARE A TRASCRIVERE LA POL III NECESSI=
TA DI TFIII (IN PARTICOLARE DEL FATTORE DI
POSIZIONAMENTO TFIIIB)
PIC DELLA RNA POLIII
tRNA;
rRNA5S
snRNA
TFIIIB È COSTITUITO DA TBP E DA
ALMENO UN TAF3
GENI DI CLASSE I
CODIFICANO PER GLI rRNA 28S; 18S e 5.8S.
rRNA 28S +5.8S + 5S +49 PROTEINE = SUBUNITA’ 60S
rRNA 18S + 33 PROTEINE = SUBUNITA’ 40S
TOTALE: PARTICELLA RIBONUCLEOPROTEICA
RIBOSOMALE 80S
NOTA: NEI PROCARIA SUB. MAGGIORE 50S (rRNA 23S + 5S + 31 PROT.);
SUB. MINORE 30S (Rrna16s + 21 PROT.). TOT.: PARTICELLA 70S
GENI DI CLASSE III
CODIFICANO PER tRNA E PER VARI snRNA
(DEGLI snRNA ABBIAMO GIA’ PARLATO RIGUARDO LO
SPLICING)
I tRNA SVOLGONO FUNZIONE DI ADATTATORE TRA
mRNA E AMMINOACIDI.
IL REALE ADATTATORE E’ L’ANTICODONE
I tRNA
• COSTITUISCONO CA. IL 10-15% DELL’RNA TOTALE DELLE CELL. EU- E
PROCARIOTICHE;
• CONSTANO DI CA. 75-90 rNTP PER UNA MASSA TOTALE DI CA. 5S;
• TUTTI HANNO LA SEQ. 5’-CCA-3’ ALL’ESTREMITA’ 3’;
• TUTTI POSS. ASSUMERE LA CONFORMAZIONE SECONDO IL MODELLO
“A TRIFOGLIO” (STRUTT. 2°);
• L’ANSA PIU’ IMP. DI TALE STRUTT. E’ L’ANTICODONE.
Fly UP