Molecular Identification of Some Egyptian Date Palm Males by females... Phoenix dactylifera L.

Journal of Applied Sciences Research 2(5): 270-275, 2006
© 2006, INSInet Publications
Molecular Identification of Some Egyptian Date Palm Males by females varieties
(Phoenix dactylifera L.) Using DNA Markers
1
M.M.M. Ahmed, 2S.S. Soliman and 1E.H. Elsayed
1
Nucleic Acid Research Dept., Genetic Engineering & Biotechnology Research Institute (GEBRI),
Mubarak City For Scientific Research and Technology Applications, Alexandria, Egypt.
2
National Research Center (NRC), Horticultural Technology Department, Dokki, Cairo, Egypt.
Abstract: Genomic DNA and RNA were extracted, measured and used as template to detect genetic
relationship and similarities among four known females [Sakkoty, Malkabi, Bartamoda and Dagana cultivars]
and three unknown males of Egyptian date palm based on DNA and RNA technology. Differential display
technique using specific primers for ribosomal RNA genes and RAPD molecular markers were extensively used
in this study. The percentages genetic similarity between Egyptian males by females was analyzed at the DNA
level by polymerase chain reaction (PCR) using random primers to detect genetic similarity. RAPD technique
was applied using five primers of 10 mer and one primers of 20 mer. The results showed that the highest
similarities percentages in the mains of similarity were 91.2, 86.5, 81.2 and 79.0 with males 1, 2 and 3 are
genetically closely related to Malkabi, Bartamoda, Sakkoty and Dagana cultivars respectively. Differential
display results obtained by the primers specific for 18s r RNA gene showed no difference between the tested
varieties [females and males]. Whenever, the primer specific for ITS region grouped the 7 varieties into two
groups. Group one included by varieties 3, 7, 2 and 1 but group two included varieties 6, 4 and 5. Also, the
results showed that differential display and RAPD analysis provided a rapid and effective method to detect the
genetic relationship and similarities betweenfour males and females of Egyptian date palm. In addition Sakkoty
and Malkabi cultivars gave the highest moisture content percentage in the second season. Malkabi cultivars
gave the highest total soluble solids followed by sakkoty cultivar, while, Bartamoda cultivar gave the highest
total and reducing sugars percentage followed by Sakkoty cultivars.
Key words: Date palm, male, females, varieties, RAPD-PCR, analysis
INTRODUCTION
the one employing DNA can show much more variation
in the genome.
The recently developed techniques, based on the
polymerase chain reaction (PCR), offer a new tool for
construction of linkage maps. The arbitrarily primed PCR
[AP-PCR][3] as well as the random amplified polymorphic
DNA (RAPD) technique [5] utilizes arbitrary primers for
the amplification of template DNA. The (RAPD)
technique utilizes decamer primer arbitrary sequence with
a GC content < 50%. As time consuming and expensive
synthesis of special primers can be avoided, a set of
commercially available primers can be used for different
species [7] . The use of arbitrary primers for evolution
studies and linkage analysis has been found effective in
several plant species [8,9].
RNA fingerprinting using arbitrarily primed PCR
(RAP)[4] and a similar method[10] allow the semi
quantitative simultaneous comparison of the abundances
of several hundred randomly sampled RNAs. In RAP
Date palm (Phoenix dactylifera L.), a long-living
monocotyledon plant is of economic importance in Egypt
and all North Africa. It presents a source of income to
Oases inhabitants and creates favorable conditions for
improving secondary crop culture like Barley, Alfalfa and
Clover as forage.
Most genetic diversity studies in plants has
been using isozymes as markers, because isozymes
require relatively lower cost compared to other
molecular markers, such as RFLP or RAPD. Using
isozymes with its co-dominance inheritance also
make it is possible to detect heterozygous
individuals [1]. Using isozymes,however, has disadvantage
of understanding the amount of genetic variation
present in a natural population[2], because isozymes
loci can only represents a small portion of the total
plant genome. Other molecular markers, especially
Corresponding Author:
E.H. Elsayed, Nucleic Acid Research Department, Genetic Engineering and Biotechnology Research
Institute (GEBRI), Mubarak City for Scientific Research and Technology Applications, Alexandria,
Egypt.
E-mail: [email protected]
270
J. Appl. Sci. Res., 2(5): 270-275, 2006
Table 1: The sequence of the primers used and its annealing
temperatures.
Primer
Sequence 5`- 3`
Annealing Tm °C / Sec
ATG CCC CTG T
30/30
1
GAA TGC GAC G
40/30
2
3
AGG CCC CTG T
30/30
4
AAA GCT GCG G
30/30
5
ACC GCC GAA G
30/30
6
CAG GCC CTT CCA GCA CCC AC
54/30
ITS1
TCCGTAGGTGAACCTGCGG
51/60
GCAAGTCTGGTGCCAGCAGCC
54/60
NS3
first-strand cDNA synthesis by reverse transcriptase is
initiated from an arbitrarily chosen primer at sites in the
RNA that best match the primer. Second-strand synthesis
is initiated by extension of the same arbitrary primer at
sites of adequate match on the first-strand cDNA product
by using Taq polymerase. The products of cDNA
synthesis are then amplified by PCR and displayed on a
gel as a fingerprint representing between 10 and 50
RNAs, depending on the choice of arbitrary primer. Any
differences in the pattern produced by a primer in
different RNA populations reflect abundance differences
in individual RNAs. Many fingerprints can be displayed
on a single gel, allowing the simultaneous comparison of
abundances for several hundred RNAs. In other studies,
RNA fingerprinting has been used to identify transcripts
that are aberrantly regulated in human tumors [11,12],
differentially expressed during mouse brain
development[14] or differentially expressed during
peroxide stress in Salmonella [13]. As we demonstrate in
this study, RAP fingerprinting can be used to differentiate
RNAs from different plant materials even these plant
materials taken from very closely plant verities.
Genetic diversity among 13 different cultivars of date
palm (Phoenix dactylifera L.) of Saudi Arabia was studied
using random amplified polymorphic DNA (RAPD)
markers. The results of the analysis can be used for the
selection of possible parents to generate a mapping
population. The variation detected among the closely
related genotypes indicates the efficiency of RAPD
markers over the morphological and isozyme markers for
the identification and construction of genetic linkage
maps[15,16].
The objectives of the present study were to identify
unknown males of Egyptian date palm through known
females varieties then used that results in breeding
programmer and improving physical and chemical fruit
characteristics.
continuing grinding. Additional 900 µl of the extraction
buffer was subsequently added before the tube was
incubated at 65°C for 30 min. The sample was then
cooled to ambient temperature and washed by adding 200
µl of wet chloroform (Chloroform:octan-1-ol= 24:1). The
mixture was gently mixed and centrifuged at 13000 rpm
for 2 min. The aqueous layer was removed and subjected
to second washing process, by adding 500 µl of wet
chloroform. The DNA was precipitated from the aqueous
layer by adding 600 µl ice-cold propan-2-ol at room
temperature for 10-15 min. After centrifugation at 13000
rpm for 2 min, the DNA pellet was washed with 1 of wash
buffer (76% ethanol, 10 mM ammonium acetate) and
stands at room temperature for 20 min, before subjected
to another centrifugation. The supernatant was discarded,
and the DNA was air dried by inverting the tube for about
15 minutes. The DNA was then dissolved in 100 µL TE
buffer (10 mM Tris-HCl pH 7.6; 1 mM EDTA) and stored
at 4°C until used.
RNA extraction: Total RNAs of the plant tissue prepared
using the RNAeasy kit according to manufacturer's
instructions [QIAGEN]. The RNA was dissolved in
DEPC-treated water, quantitated spectrophotometrically,
and total RNA analyzed on 1.2% agarose gel.
RAPD and Differential display analysis: Random
Amplified Polymorphic DNA (RAPD) was carried
out using five random primers according to[4].
Primers used in the differential display analysis
were synthesized in MWG Biotech (NS3 and ITS1)
according to[18].
The
polymerase
chain
reaction
mixture
consisted of 0.8 U of Taq DNA polymerase (Fanzyme),
0.1 mM dNTPs, and 25 pmol of random primer, 2.5 mL.
10X Taq DNA polymerase buffer and 50 ng of
genomic DNA. The final reaction volume of 25 µl was
placed in a DNA thermal cycler (Perkin Elmer 9700). The
PCR programme included an initial denaturation
step at 94°C for 2 mins followed by 45 cycles with
94°C for 1 min for DNA denaturation, annealing as
mentioned with each primer, extension at 72°C for 30
seconds and final extension at 72 °C for 10 minutes
were carried out. The samples were cooled at 4°C. The
amplified DNA fragments were separated on 2% agarose
MATERIALS AND METHODS
Plant materials: Leaves of Dat e palm were collected
from Aswan , Egypt. Date palm studied included: seven
samples four known females (Sakkoty, Malkabi,
Bartamoda and Dagana cultivars) and three unknown
males.
Extraction of DNA and RNA:
DNA extraction: DNA was extracted from fresh
materials according to modified mini-prep CTAB
method[17]. About 0.5 g leaf tissue was put into mortar in
liquid nitrogen before ground to a fine powder using
disposable plastic grinders. The powder was then mixed
to homogenous slurry with 100-µl-extraction buffer (100
mM Tris-HCl pH 8.0, 20 mM Na2EDTA, 1.4 M NaCl,
2% w/v CTAB, 0.2% v/v 2-mercaptoethanol) while
271
J. Appl. Sci. Res., 2(5): 270-275, 2006
t o [ 2 1 ] and the titrable acidity was calculated as citric
acid [22].
gel and stained with ethidium bromide. F X174 DNA
marker [bp 1353, 1078, 872,….., 72] Used in this study.
The amplified pattern was visualized on a UV transilluminator and photographed.
Total soluble sugars: It was determined according to [23]
in the metabolic extract using the phenol sulphuric acid
method and the percentage was calculated per dry weight.
Scoring and analysis of RAPDs: The DNA bands were
scored for their presence 1 or absence 0 in the RAPD
profile of the seven date palm varieties. The index of
similarity between each two varieties was calculated using
the formula: Bab =2 Nab /[N a + Nb ], where Nab is the
number of common fragments observed in individuals a
and b and Na and Nb are the total number of fragments
scored in a and b respectively [19]. The BS values were
calculated for each primer separately and average for all
primers was carried out with each comparison .
Dendrogram was constructed using the Average Linkage
between Groups[20].
Reducing soluble sugars: It was determined in the
metabolic extract according to [21 ] . The percentage was
calculated per dry weight.
Non-reducing sugar: It was determined by the difference
between total and reducing sugars.
Statical analysis: The obtained data was subjected to
analysis of variance. Treatment means were compared
using the Ducan Multiple range test 5% level of
probability in both seasons of experimentation. The data
were tabulated and statistically analyzed according to the
randomized complete blocks design method[24].
Differential display analysis:
Differential displ ay using 18s r RNA gene: PCR
amplification using 18s r RNA gene, 2.5 µl from each
RNA was combined with 5 µl of a 2x reverse
transcription mixture containing 50 mM Tris-HCl (pH
8.3), 50 mM KCI, 4 mM MgCl2, 20 mM dithiothreitol,
2.5µl dNTPs [each at 4 mM], 1 µl olig dT primer
(Promega), 13 µl of RNAs free water and 1µl [50unit/µl]
of murine leukemia virus reverse transcriptase and
incubated at 37°C for 1 hr. After this reaction, 23 µl of
Taq DNA polymerase reaction mixture containing 10 mM
Tris HCl [pH 8.3], 25 mM KCI, 4 mM MgCl2, 2µl 18S
forward primer , and 1unit of Taq polymerase (AmpliTaq,
Perkin- Elmer) was added and cycled first through 94°C
for 5 min, 40°C for 5 min, and 72°C for 5 min in 9700
thermal cycler (Perkin-Elmer), followed by 40 cycles
through 94°C for 1 min, 56°C for 1 min, and 72°C for 2
min.
RESULTS AND DISCUSSIONS
RAPD-PCR and Differential display analysis: All the
six primers examined produced different RAPD fragment
patterns (Fig. 1). Values of similarity percent estimated as
band sharing (BS) between different males and each
female were given in Table 2 showed the genetic
similarity estimated as band sharing [BS] between 4
females. The results showed that the highest similarities
percentages in the mains of similarity were 91.2, 86.5,
81.2 and 79.0 with males 1, 2 and 3 are genetically
closely related to Malkabi, Bartamoda, Sakkoty and
Dagana cultivars respectively. This result reflects the
similarity between unknown male and female varieties,
but this data is not enough to identify unknown male.
Identification of male variety exactly needs more
advanced molecular studies.
Differential display using primer ITS 1: Three µl from
the previously synthesized cDNA was added to 20 µl of
Taq DNA polymerase reaction mixture containing 10
mM Tris HCl (pH 8.3), 25 mM KCI, 4 mM MgCl2, 2µl
chitinase forward primer , and 1unit of Taq polymer a s e
(AmpliTaq, Perkin- Elmer) was added and cycled first
through 94°C for 5 min, 40°C for 5 min, and 72°C for 5
min in 9700 thermal cycler (Perkin-Elmer), followed by
40 cycles through 94°C for 1 min, 53°C for 1 min, and
72°C for 2 min.
Table 2: Genetic similarity estimated as band sharing [BS] for
eachprimer amongmales and females.
Date palm
Primers
---------------------------------------------------------------1
2
3
4
5
6
Average
86.0
75.0
80.0
86.0 50.0 100.0
79.5
1* x 5
1x6
40.0
100.0 80.0
67.0 100.0 100.0
81.2
1x7
40.0
86.0
67.0
67.0 67.0 100.0
60.0
2x5
86.0
75.0
100.0 86.0 100.0 100.0
91.2
2x6
40.0
100.0 100.0 67.0 50.0 100.0
76.2
40.0
86.0
86.0
67.0 67.0 100.0
74.3
2x7
86.0
67.0
80.0
86.0 67.0 100.0
81.0
3x5
40.0
57.0
80.0
67.0 67.0 100.0
86.5
3x6
40.0
75.0
67.0
67.0 100.0 100.0
73.2
3x7
4x5
86.0
50.0
100.0 86.0 50.0 100.0
78.7
4x6
40.0
67.0
100.0 67.0 100.0 100.0
79.0
4x 7
40.0
86.0
86.0
67.0 67.0 100.0
74.3
* 1-4 arethe four samples of females Sakkoty, Malkabi, Bartamoda
andDagana cultivarsrespectivelyand5-7 are the three samples of
males.
Fruit chemical characters:
Moisture content: According to[21].
Total soluble solids: the percentage of TSS was
determined in the fruit juice using size refractometer
A,[21].
Fruit acidity: Fruit acidity was determined according
272
J. Appl. Sci. Res., 2(5): 270-275, 2006
Table 3: Fruit chemical characteristics of Sakkoty, Malkabi,
Bartamoda and Dagana cultivars grown at Aswan
Governorate during 2004 and 2005 seasons.
Cultivars Chemical properties
2004
2005
Moisture content %
18.3b
21.4a
Total soluble solid %
53.1b
57.2a
Acidity %
0.0280a
0.0282a
Total sugars %
80.0b
83.4a
Reducing sugars
74.1b
79.3a
Non-reducing sugare %
5.9a
6.1a
--------------------------------------------------------------------------------------------------Malkabi
Moisture content %
17.6b
20.1a
Total soluble solid %
80.3a
76.3b
Acidity %
0.139b
0.0263a
Total sugars %
76.0b
78.8a
Reducing sugars
70.2b
75.0a
Non-reducing sugare %
5.8a
3.8b
--------------------------------------------------------------------------------------------------Bartamoda
Moisture content %
15.2a
14.4a
Total soluble solid %
65.3a
66.0a
Acidity %
0.0240a
0.0168b
Total sugars %
88.6a
85.3b
Reducing sugars
80.2a
80.0a
Non-reducing sugare %
8.4a
5.3b
--------------------------------------------------------------------------------------------------Dagana
Moisture content %
22.3a
23.0a
Total soluble solid %
56.0a
52.1b
Acidity %
0.035b
0.044a
Total sugars %
74.4a
72.1b
Reducing sugars
64.2a
63.5a
Non-reducing sugare %
11.2a
8.6b
Sakkoty
Fig. 1: RAPD amplification products generated from
seven samples by random primers: M is DNA
marker Lanes 1-4 are the four samples of females
(Sakkoty, Malkabi, Bartamoda and Dagana
cultivars) respectively and Lanes 5-7 are the four
samples of males.
We have observed that the small alterations in PCR
parameters or quality of target DNA can radically alter
RAPD patterns[6] The results obtained by differential
display presented in figures (2 and 3) showed that, using
primer 18s (NS3) for comparison between the 7 tested
veracities did not gave difference, but primer ITS1
grouped them into two main groups. Group one; include
varieties 1, 2, 3 and 7, whenever, group two contains
varieties 4, 5 and 6[25]. Differential display gave an
indication that the similarity between the samples is so
high when 18S primer was used but in ITS1 primer
improve the presence of differences between the
examined veracities, that it is mean that the sequence of
ribosomal RNAs gene in the examined varsities may be
very similar unless they are unique. But the sequence
dissimilarity may be present in the ITS region in the
examined verities. For that reason, ITSI succeeded to
differentiate between the examined varieties but 18S
failed. So, RNA fingerprint by arbitrarily primed PCR and
differential display of RNA have been successfully used
to isolate differentially expressed genes in two different
states of many biological systems and have been
successfully differentiate between different plant
cultivars [4,10].
The results of the analysis can be used for the
selection of possible parents to generate a mapping
population. The variation detected among the closely
related genotypes indicates the efficiency of RAPD
markers over the morphological and isozyme markers for
the iden tification and construction of genetic linkage
maps,[15,16,26], banana[17], black Aspergilli[27], parasitic
protozoa[28], and tilapia fish[29]. Thus there may be reason
Fig. 2: Differential display for 7 palm Veracities using
18S NS3 primer. Lane 1, DNA marker 3 kbp
ladder (ranged from 3kbp t0 50 bp), lanes from
1-7 is the palm samples from 1-7 respectively.
to view with caution systematic conclusions based on
RAPD analysis alone. On the other hand. The possibility
of carrying out compatibility analysis with unlimited
numbers of primers, each detecting variation at several
regions in the genome, provides an advantage over other
techniques. Even if some primers amplify identical
regions of the genome or if the technique itself is noisy,
it should be possible to build up quickly a consensus from
patterns of interpopulation variation.
Fruit chemical characters: Data concerning the
chemical properties of the fruits in the two seasons are
presented in Table 3. A significant differences in moisture
content percentage of Sakkoty, Malkabi, Bartamoda and
Dagana cultivars were observed, both of Sakkoty and
273
J. Appl. Sci. Res., 2(5): 270-275, 2006
(70.2 and 75.0 %) and finally by Dagana cv (64.2 and
63.5 %), in the first and second seasons respectively.
The obtained results are in agreement with those
found by [34,35]. Non-reducing sugars percentage and the
data indicated were significant differences in all cultivars.
Dagana cv. gave the highest values (11.2 and 8.6 %)
followed by Batamoda cv. (8.4 and 5.3 %), Sakkoty cv.
(5.9 and 6.1 %) and Malkabi cv. (5.8 and 3.8 %) and the
results are in agreement with those found by[34,35].
REFERENCES
Gillies, A.C.M., J.P. Comelius, C. Newton, C.
Nawarro, M. Hernandez, and J. Wills on, 1997.
Genetic variation in Costa Rican population of the
tropical timber species Cedrela odorata L.,
assessed using RAPDs. Moles. Ecol. 6: 1133-1145.
2. Storfar, A., 1996. Quantitative genetics: A promising
approach for the assessment of genetic variation
in endangered species. Trends in Ecol. Evol.
11: 343-348.
3. Welsh, J. and M. McClelland, 1990. fingerprinting
genome-using PCR with arbitrary primers. Nucleic
Acid Research 18: 7213-7218.
4. Welsh, J., K. Chada, S.S. Dalal, R. Cheng, D. Ralph
and M. McClelland, 1992. Arbitrarily primed
PCR fingerprinting of RNA. Nucleic Acids Res
20: 4965-4970.
5. Williams, J.G.K., A.R. Kublik, K.J. Livak, J.A.
Rafalski, and S.V. Tingey, 1990. DNApolymorphism
amplified by arbitrary primers are useful as genetic
markers. NucleicAcid Research 18: 6531–6535.
6. Williams, J.G.K., M.K. Hanafey, J.A. Rafalski and
S.V. Tingey, 1993. Genetic analysis using random
amplified polymorphic DNA markers. Methods
Enzymol., 218:704-740.
7. Klein-Lankhorst, R.M., A. Vermunt, R. Weide, T.
Liharska and P. Zabel, 1991. Isolation of molecular
markers for tomato L. esculentum using random
amplified polymorphic DNA (RAPD). Theor. Appl.
Genet. 81, 661-667.
8. Halward, T., T. Stalker, E. Larue and G. Kochert,
1992. Use of single-primer DNA amplifications in
genetic studies of peanut Aracbis bypogaea L.
Plant Mol. Biol., 18, 315-325.
9. Carlison, J.E., L.K. Tulsieram, J.C. Glaubitz, V.W.K.
Luk, C. Kauffeldt and R. Rutledge, 1991.
Segregating of random amplified DNA markers
in F1 progeny of conifers. Theor. Appl. Genet.,
83, 194-200.
10. Liang, P. and A. Pardee, 1992. Differential display
of eukaryotic messenger RNA by means of the
polymerase chain reaction. Science, 257, 967-971.
1.
Fig. 3: Differential display for 7 plant veracities using
primer ITS1 gene. Lane: 1, DNA marker VIII
(ranging from 1,3 kbp to 50 bp).Lanes 1 to7 is
samples from 1-7 respectively.
Malkabi fruits gave the highest moisture content percent
(21.4 %) and (20.1 %) in the second season as compared
with in the first season, [18.3 %] and [17.6 %]
respectively.
The same observation was recorded by [30,31].
Whenever, the total soluble solids (TSS %): In addition,
results indicated that the total soluble solids percentage
was significantly different in Sakkoty, Malkabi and
Dagana cultivars, Malkabi dates gave the highest total
soluble solids percentage (80.3 and 76.3 %) as compared
with Sakkoty dates (53.1 and 57.2 %) and Dagana dates
(56.0 and 52.1 %). While Bartamoda dates values (65.3
and 66.0 %) in the first and second seasons was observed
in respective manner, these results are in agreement with
those reported by [31]. In addition, the total acidity
percentage showed significantly different in all cultivars,
Malkabi cv. gave the highest values (0.134 and 0.263 %)
followed by Dagana cv. (0.035 and 0.044 %), Sakkoty cv.
(0.0280 and 0.0282 %) and Batamoda cv. (0.0240 and
0.0186 %) in the first and second seasons, and the data
comes in agreement with those reported by[30,32].
Concerning total sugars percentage, the results
indicated that there are significant differences in
respective manner starting with Sakkoty, Malkabi,
Bartamoda and finally Dagana cultivars. Bartamoda cv.
gave the highest total sugar percent [88.6 and 85.3 5]
followed by Sakkoty cv. (80.0 and 83.4 %), Malkabi (76.0
and 78.8 %) and Dagana cv. (75.4 and 72.1 %) in the first
and second season, respectively. These results are in
agreement with those found by [ 3 0 , 3 3 ]. Significant
differences were detected in reducing sugar percentage in
t wo seasons, Bartamoda cv. gave the highest reducin g
sugar percentage [80.2 and 80.0 %] than those that
obtained by Sakkoty cv. [74.1 and 79.3 %], Malkabi cv.
274
J. Appl. Sci. Res., 2(5): 270-275, 2006
11. Liang, P., L. Averboukh, K. Keyomarsi, R. Sager and
A.B. Pardee, 1992. Transcriptional Regulation of
the SIS/PDGF-B Gene in Human Osteosarcoma
Cells by the Sp Family of Transcription Factors
Cancer Res. 52, 6966-6968.
12. Wong, K.K., M.A. McClelland, 1992. Bln I
restriction map of the Salmonella typhimurium LT2
genome. J Bacteriol. 174 (5):1656-1661.
13. Wong, K.K. and M. McClelland, 1994. Stressinducible gene of Salmonella typhimurium identified
by arbitrarily primed PCR of RNA. Proc. Natl.
Acad Sci. U.S.A. 18;91(2):639-643.
14. McClelland, M., K. Chada, J. Welsh, and D. Ralph,
1993. In DNA Fingerprinting: State of the Science
Symposium, eds.Pena, S.D., Charkraborty, R.,
Epplen, J.T. and Jeffereys, A. J. Birkhauser, Basel,
pp. 103-115.
15. Al-Khalifah, N.S. and E. Askari, 2003. Molecular
phylogeny of date palm (Phoenix dactylifera L.)
cultivars from Saudi Arabia by DNA fingerprinting.
Theor. Appl. Genet. 107(7): 1266-70.
16. Soliman, S.S and B.A. Ali, M.M.M. Ahmed, 2003.
Genetic comparisons of Egyptian datepalm cultivars
(Phoenix dactylifera L.) by RAPD-PCR.African
Journal of Biotechnology, Vol. 2(4), pp. 86-87.
17. Kaemmer, D., R. Afza, K. Weising, G. kahi and F.J.
Novak, 1992. Oligonucleiotide and amplification
fingerprinting of wild-species and cultivars of banana
(Musa spp.). Biotechnology 10: 30-35.
25. Ching-Yu Lin, Cheng-Chun Kuan, Rong-Huay
Juang, C.S. Samson, C. Tsou, George Kuoand
Ching-San Chen. 1997. Rapid isolation of
differentially expressed cDNAs from near isogenic
lines of mungbean. Bot. Bull. Acad. Sin., 39: 87-91.
26. Chalmers, K.J., R. Waugh, J.I. Sprent, A.J. Simons
and L.W. Powel, 1992. Detection of genetic variation
between and within populations of Gliricidia sepium
and G. maculata using RAPD markers. Heredity
69: 465-472.
27. Megnegneau, B., F. Debets and R.F. Hoextra, 1993.
Genetic variability and relatedness in the complex
group of black Aspergilli based on random
amplification of polymorphic DNA. Curr. Genet., 23:
323-329.
28. Tibayrenc, M., K. Neubauer, C. Barnabe, F. Guerrini,
D. Skarecky and F.J. Ayala, 1993. Genetic
charcterization of six parasitic protozoa: Parity
between random-primer DNA typing and multilocus
enzyme electrophoresis. Proc. Natl. Acad. Sci.
U.S.A., 90: 1335-1337.
29. Baradakci, F. and D.O.F. Skibinski, 1994.
Application of the RAPDtechnique in tilapia fish:
species and subspecies identification. Heredity,
73: 117-123.
30. Hussein, F., G.F. Sourial and I.A. Mousa, 1998.
Effect of pruning on yield and fruit quality of
Bartamoda date cultivar under condition of Aswan
governrate. Zagazig, J. Agric. Res., 25(5): 773-783.
31. Hussein, A.A.M., N.M.I. Attia and S.M. Osman,
2001. Survay and evaluation of fruit cultivars for
some species grown under Siwa Oasis. 11. Date palm
A nnal of Agric. Sci., Moshtohor, 39 (2): 1265-1278.
32. Soliman, S.S., 1999. Effect of poleen source on
fruiting and fruit characteristic of two palm
cultivars’’ Samani and Sakkoty’’. Ph.D. Thesis. Fac.
Agric. Cairo univ.
33. El-Shazly, S.M., 1999. Effect of fruit thinning on
yield and fruit of Nabtet Ali Saudi date palm. The
international conference on date palm in Adduit
Univ. Nov. 9-11:17-33.
34. Soliman, S.S. and S.M. Osman, 2001. Effect of
Bunch/Leaves ratio on fruit physical and chemical
characterization inGondaila and Dagana date palm
cultivars. Minufiya J. Agric. Res., 26 (3): 825-835.
35. Osman, S.M. and S.S. Soliman 2001. Effect of
thinning of fruiting and fruit characteristics of some
dry date palm cultivars under Aswan conditions.
Minufiya J. Agric. Res., 26: (3) 845-858.
18. White, J.W. and J.A. Castillo,1990. Association
between productivity, root growth and carbon
isotope discrimination in Phaseolus vulgaris under
water deficit. Australian Journal Of Plant Physiology
17(2): 189-198.
20. M. Lynch, 1990. The similarity index and DNA
fingerprinting. Mol. Biol. Evol., 7, 478-484.
21. Sneath, P.H.A., R.R. Sokal ,1973. Numerical
taxonomy, W. H. Freeman, San Francisco.
Association of Official Agriculture Chemistes 1995.
Officical Methods of Analysis A. O. A. C. 15th Ed.
Published by A.O.A.C. Washington, D.C. (USA).
22. Mawlood, E.A., 1980. Physiological studies on fruit
development of Samani and Zaghoul date palm
cultivars. Ph.D. Thesis, Fac., Agric., Cairo Univ.,
Egypt.
23. Smith, F., M.A. Gilles, J.K. Hamilton and P.A.
Godess,
1956. Colorimetric method for
determination of sugars related substances. Anal.
Chem., 28:350-356.
24. Snedecor, G.W. and W.G. Cochran 1980. “Statistical
method” Oxford and J.B. H. Publishing com. 6th
Edition.
275